gltC

168

transcriptional activator/ repressor of the gltA-gltB operon, activates expression of the operon in the absence of arginine, represses in the presence of glutamate

Locus: BSU_18460

Molecular weight: 33.87 kDa

Isoelectric point: 5.62

Protein length: 300 aa

Gene length: 903 bp

Function: regulation of the glutamate synthase operon (gltA-gltB)

Product: transcriptional regulator (LysR family)

Essential: No

Synonyms: gltC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0583 (Galperin et al., 2021)

Gene

Coordinates: 2,014,779  2,015,681

Phenotypes of a mutant

• gltC mutants  are auxotrophic for glutamate, this can be suppressed by the gltR24 mutation or by amplification of the gltA-gltB genomic region PubMed

The protein

Catalyzed reaction/ biological activity

• transcription activation of the gltA-gltB operon PubMed

Protein family

• LysR family (according to UniProt) PubMed

Domains

• DNA-binding helix-turn-helix motif: AA 18 ... 37
• HTH lysR-type domain (aa 1-58) (according to UniProt)

Structure

• 2H99 (PDB) (from Acinetobacter baylyi, corresponds to aa 1 - 245, 35% identity) PubMed
• P20668 (AlphaFold)

Effectors of protein activity

• 2-oxoglutarate stimulates transcription activation, glutamate inhibits transcription activation PubMed

Expression and Regulation

Operons

• Genes: gltC

  Description: PubMed

  Regulation

  • autoregulation by GltC PubMed

  Regulatory mechanism

  • GltC: auto-repression, PubMed, in gltC regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• GP344 (erm), (available in Jörg Stülke's lab)
• GP738 (gltC::Tn10, spc), (available in Jörg Stülke's lab)
• GP1904 (gltC::aphA3), (available in Jörg Stülke's lab) PubMed
• BKE18460 (gltC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTTGTCTCACATCCAT,  downstream forward: _UP4_TAAAAAAAATGAACCCGAGC
• BKK18460 (gltC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTTGTCTCACATCCAT,  downstream forward: _UP4_TAAAAAAAATGAACCCGAGC

Expression vectors

• for expression, purification in E. coli with N-terminal His-tag, in pWH844: pGP903,  available in Jörg Stülke's lab
• for expression, purification in E. coli with C-terminal Strep-tag, in pET3C: pGP951,  available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

• available in Jörg Stülke's lab

Labs working on this gene/protein

• Linc Sonenshein, Tufts University, Boston, MA, USA Homepage
• Jörg Stülke, University of Göttingen, Germany Homepage
• Fabian Commichau Senftenberg, Germany homepage

References

Reviews

Gunka K, Commichau FM Control of glutamate homeostasis in Bacillus subtilis: a complex interplay between ammonium assimilation, glutamate biosynthesis and degradation. Molecular microbiology. 2012 Jul; 85(2):213-24. doi:10.1111/j.1365-2958.2012.08105.x. PMID:22625175
Brantl S, Licht A Characterisation of Bacillus subtilis transcriptional regulators involved in metabolic processes. Current protein & peptide science. 2010 Jun; 11(4):274-91. . PMID:20408793

Original Publications

Warneke R, Herzberg C, Weiß M, Schramm T, Hertel D, Link H, Stülke JDarA-the central processing unit for the integration of osmotic with potassium and amino acid homeostasis in Bacillus subtilis.Journal of bacteriology. 2024 Jun 4; :e0019024. PMID: 38832794
Dormeyer M, Lentes S, Richts B, Heermann R, Ischebeck T, Commichau FM Variants of the LysR-Type Regulator GltC With Altered Activator and Repressor Function. Frontiers in microbiology. 2019; 10:2321. doi:10.3389/fmicb.2019.02321. PMID:31649652
Dormeyer M, Lübke AL, Müller P, Lentes S, Reuß DR, Thürmer A, Stülke J, Daniel R, Brantl S, Commichau FM Hierarchical mutational events compensate for glutamate auxotrophy of a Bacillus subtilis gltC mutant. Environmental microbiology reports. 2017 Mar 13; . doi:10.1111/1758-2229.12531. PMID:28294562
Stannek L, Thiele MJ, Ischebeck T, Gunka K, Hammer E, Völker U, Commichau FM Evidence for synergistic control of glutamate biosynthesis by glutamate dehydrogenases and glutamate in Bacillus subtilis. Environmental microbiology. 2015 Sep; 17(9):3379-90. doi:10.1111/1462-2920.12813. PMID:25711804
Gunka K, Newman JA, Commichau FM, Herzberg C, Rodrigues C, Hewitt L, Lewis RJ, Stülke J Functional dissection of a trigger enzyme: mutations of the bacillus subtilis glutamate dehydrogenase RocG that affect differentially its catalytic activity and regulatory properties. Journal of molecular biology. 2010 Jul 23; 400(4):815-27. doi:10.1016/j.jmb.2010.05.055. PMID:20630473
Craven SH, Ezezika OC, Haddad S, Hall RA, Momany C, Neidle EL Inducer responses of BenM, a LysR-type transcriptional regulator from Acinetobacter baylyi ADP1. Molecular microbiology. 2009 May; 72(4):881-94. doi:10.1111/j.1365-2958.2009.06686.x. PMID:19400783
Commichau FM, Herzberg C, Tripal P, Valerius O, Stülke J A regulatory protein-protein interaction governs glutamate biosynthesis in Bacillus subtilis: the glutamate dehydrogenase RocG moonlights in controlling the transcription factor GltC. Molecular microbiology. 2007 Aug; 65(3):642-54. . PMID:17608797
Commichau FM, Wacker I, Schleider J, Blencke HM, Reif I, Tripal P, Stülke J Characterization of Bacillus subtilis mutants with carbon source-independent glutamate biosynthesis. Journal of molecular microbiology and biotechnology. 2007; 12(1-2):106-13. . PMID:17183217
Picossi S, Belitsky BR, Sonenshein AL Molecular mechanism of the regulation of Bacillus subtilis gltAB expression by GltC. Journal of molecular biology. 2007 Feb 02; 365(5):1298-313. . PMID:17134717
Belitsky BR, Sonenshein AL Modulation of activity of Bacillus subtilis regulatory proteins GltC and TnrA by glutamate dehydrogenase. Journal of bacteriology. 2004 Jun; 186(11):3399-407. . PMID:15150225
Wacker I, Ludwig H, Reif I, Blencke HM, Detsch C, Stülke J The regulatory link between carbon and nitrogen metabolism in Bacillus subtilis: regulation of the gltAB operon by the catabolite control protein CcpA. Microbiology (Reading, England). 2003 Oct; 149(Pt 10):3001-9. . PMID:14523131
Belitsky BR, Sonenshein AL Mutations in GltC that increase Bacillus subtilis gltA expression. Journal of bacteriology. 1995 Oct; 177(19):5696-700. . PMID:7559360
Bohannon DE, Sonenshein AL Positive regulation of glutamate biosynthesis in Bacillus subtilis. Journal of bacteriology. 1989 Sep; 171(9):4718-27. . PMID:2548995