yndF
168
part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF] germinant receptor of unknown specificity
locus
BSU_17770
Molecular weight
44.66 kDa
pI
7.26
function
[category|SW.4.2.4|Germination]
product
part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF] germinant receptor
essential
no
synonyms
yndF
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG5903 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
1,910,167 1,911,381
Phenotypes of a mutant
increased resistance to predation by Dictyostelium discoideum [pubmed|40991432]
The protein
Protein family
[wiki|GerABKC lipoprotein family] (according to UniProt)
Structure
[PDB|3N54] ([protein|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC], 29% identity) [pubmed|20654628]
[AF|O31810]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]
description
[Pubmed|16497325]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Biological materials
Mutant
MGNA-A024 (yndF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/24 NBRP B. subtilis, Japan]
BKE17770 ([gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCAGGCAATTGACGTT, downstream forward: _UP4_TAATGAATCCCAAGGAAGAG
BKK17770 ([gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCAGGCAATTGACGTT, downstream forward: _UP4_TAATGAATCCCAAGGAAGAG
References
Page visits: 4734
Time of last update: 2025-10-24 22:58:08
Author of last update: Jstuelk