fliE

168

flagellar hook-basal body protein

Locus: BSU_16200

Molecular weight: 11.44 kDa

Isoelectric point: 4.49

Protein length: 106 aa

Gene length: 321 bp

Function: movement and chemotaxis

Product: flagellar hook-basal body protein

Essential: no

Synonyms: fliE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1677 (Galperin et al., 2021)

Gene

Coordinates: 1,692,130  1,692,450

Phenotypes of a mutant

• defective in Swarming and flagellar assembly PubMed

The protein

Catalyzed reaction/ biological activity

• part of the flagellar rod-hook (in FliE-FlgB-FlgC-FlhO-FlhP-FlgE out, connection to Hag) PubMed

Protein family

• fliE family (single member, according to UniProt)

Structure

• P24502 (AlphaFold)

Localization

• bacterial flagellum basal body (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • SwrA: activation, in swrA regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SinR: transcription elongation, binding of the SinR-SlrR heteromer to sites within fliE and fliI results in inhibition of transcription elongation PubMed, in sinR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

Biological materials

Mutant

• BKE16200 (fliE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACATTCATTCACCTACTTT,  downstream forward: _UP4_TAGGGGGTCTGACGATTTAG
• BKK16200 (fliE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACATTCATTCACCTACTTT,  downstream forward: _UP4_TAGGGGGTCTGACGATTTAG

References

Loading