dppA

168

D-alanyl-aminopeptidase

Locus: BSU_12920

Molecular weight: 30.09 kDa

Isoelectric point: 5.19

Protein length: 274 aa

Gene length: 825 bp

Function: degradation of cell wall peptides

Product: D-alanyl-aminopeptidase

Essential: no

E.C.: null

Synonyms: dppA, dciAA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2362 (Galperin et al., 2021)

Gene

Coordinates: 1,360,401  1,361,225

The protein

Protein family

• peptidase M55 family (single member, according to UniProt)

Structure

• 1HI9 (PDB)
• P26902 (AlphaFold)

Modification

• phosphorylated on ser/ thr/ tyr PubMed

Expression and Regulation

Operons

• Genes: dppA-dppB-dppC-dppD-dppE

  Description: PubMed

  Regulation

  • repressed by glucose (2.9-fold) PubMed

  Regulatory mechanism

  • CodY: repression, PubMed, in codY regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

• Genes: dppA-dppB-dppC-dppD-dppE-ykfA-ykfB-ykfC-ykfD

  Description: PubMed

  Regulatory mechanism

  • CodY: repression, PubMed, in codY regulon

Biological materials

Mutant

• BKE12920 (dppA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAACGCTCCTCCTTTTTT,  downstream forward: _UP4_TTCTGCTAAAGGGGTGTTTT
• BKK12920 (dppA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAACGCTCCTCCTTTTTT,  downstream forward: _UP4_TTCTGCTAAAGGGGTGTTTT

References

. . PMID: 19602397
Belitsky BR, Sonenshein AL Genetic and biochemical analysis of CodY-binding sites in Bacillus subtilis. Journal of bacteriology. 2008 Feb; 190(4):1224-36. . PMID:18083814
Lévine A, Vannier F, Absalon C, Kuhn L, Jackson P, Scrivener E, Labas V, Vinh J, Courtney P, Garin J, Séror SJ Analysis of the dynamic Bacillus subtilis Ser/Thr/Tyr phosphoproteome implicated in a wide variety of cellular processes. Proteomics. 2006 Apr; 6(7):2157-73. . PMID:16493705
Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metabolic engineering. 2003 Apr; 5(2):133-49. . PMID:12850135
Molle V, Nakaura Y, Shivers RP, Yamaguchi H, Losick R, Fujita Y, Sonenshein AL Additional targets of the Bacillus subtilis global regulator CodY identified by chromatin immunoprecipitation and genome-wide transcript analysis. Journal of bacteriology. 2003 Mar; 185(6):1911-22. . PMID:12618455
Slack FJ, Serror P, Joyce E, Sonenshein AL A gene required for nutritional repression of the Bacillus subtilis dipeptide permease operon. Molecular microbiology. 1995 Feb; 15(4):689-702. . PMID:7783641
Slack FJ, Mueller JP, Strauch MA, Mathiopoulos C, Sonenshein AL Transcriptional regulation of a Bacillus subtilis dipeptide transport operon. Molecular microbiology. 1991 Aug; 5(8):1915-25. . PMID:1766371
Slack FJ, Mueller JP, Strauch MA, Mathiopoulos C, Sonenshein AL Transcriptional regulation of a Bacillus subtilis dipeptide transport operon. Molecular microbiology. 1991 Aug; 5(8):1915-25. . PMID:1766371