slrA

168

negative regulator of the fla-che operon, anti-repressor, antagonist SinR for the repression of the epsA→epsO and tapA-sipW-tasA operons

Locus: BSU_38229

Molecular weight: 6.00 kDa

Isoelectric point: 9

Protein length: 52 aa

Gene length: 159 bp

Function: control of motility and biofilm formation

Product: antagonist of SinR and SlrR

Essential: no

Synonyms: slrA

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Regulation of gene expression, Transcription factors and their control, Control of transcription factor (other than two-component system)

Information processing, Regulation of gene expression, Transition state regulators

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation, Regulation

Lifestyles, Exponential and early post-exponential lifestyles, Swarming

List of homologs in different organisms

This gene is a member of the following regulons

YwcC regulon

Gene

Coordinates: 3,923,319 → 3,923,477

RNA

Additional information

the mRNA has long 5' and 3' UTRs (170 and 330 nt, respectively) PubMed

The protein

Catalyzed reaction/ biological activity

binding of SinR resulting in induction of SinR-repressed genes and operons PubMed

Domains

Sin domain (aa 1-38) (according to UniProt)

Structure

P0C8M5 (AlphaFold)

Effectors of protein activity

SlrR inhibits activity of SlrA (i. e. binding to SinR) PubMed

Paralogous protein(s)

SinI

Expression and Regulation

Operons

Genes: slrA

Description: PubMed

Regulatory mechanism

YwcC: repression, PubMed, in ywcC regulon

Additional information

increased expression in a pnpA mutant PubMed
half-life of the mRNA: 0.56 min, this increases to 1.06 in a pnpA mutant PubMed
RNA degradation by PnpA is proceeds from the 3' end of the mRNA through the Rho-dependent terminator PubMed
transcription termination depends on Rho PubMed

Biological materials

Mutant

BKE38229 (ΔslrA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGTAACCTCCAATTGTA,  downstream forward: _UP4_TAGTCCGAACAGGCGGATCT
BKK38229 (ΔslrA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGTAACCTCCAATTGTA,  downstream forward: _UP4_TAGTCCGAACAGGCGGATCT

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Stülke lab

References

Loading