metE

168

methionine synthase

Locus: BSU_13180

Molecular weight: 86.64 kDa

Isoelectric point: 4.84

Protein length: 762 aa

Gene length: 2289 bp

Function: biosynthesis of methionine

Product: methionine synthase

Essential: no

E.C.: 2.1.1.14

Synonyms: metE, metC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0620 (Galperin et al., 2021)

Gene

Coordinates: 1,383,320 1,385,608

The protein

Catalyzed reaction/ biological activity

• 5-methyltetrahydropteroyltri-L-glutamate + L-homocysteine --> L-methionine + tetrahydropteroyltri-L-glutamate (according to UniProt)

Protein family

• vitamin-B12 independent methionine synthase family (single member, according to UniProt)

Structure

• 1T7L (PDB) (from Thermotoga maritima, 44% identity, 61% similarity) PubMed
• P80877 (AlphaFold)

Modification

• phosphorylated on ser/ thr/ tyr PubMed, S-cysteinylation after diamide stress (C719) PubMed
• Cys719 and Cys730 are S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species PubMed PubMed
• MetE is generally most strongly S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species PubMed PubMed

Additional information

• subject to Clp-dependent proteolysis upon glucose starvation PubMed
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: metE

  Regulation

  • repressed by casamino acids PubMed
  • the S-box RNA is degraded by RNase Y PubMed

  Regulatory mechanism

  • S-box: RNA switch, , the S-box riboswitch binds S-adenosylmethionine resulting in termination PubMed, in S-box

Biological materials

Mutant

• 1A607 ( metE::erm), PubMed, available at BGSC
• BKE13180 (metE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGTTTCTCCTCCTTTAT, downstream forward: _UP4_TAATTTGAAAAAACCATCTG
• BKK13180 (metE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGTTTCTCCTCCTTTAT, downstream forward: _UP4_TAATTTGAAAAAACCATCTG

References

Reviews

Loi VV, Rossius M, Antelmann H Redox regulation by reversible protein S-thiolation in bacteria. Frontiers in microbiology. 2015; 6:187. doi:10.3389/fmicb.2015.00187. PMID:25852656

Original Publications

DeLoughery A, Lalanne JB, Losick R, Li GW Maturation of polycistronic mRNAs by the endoribonuclease RNase Y and its associated Y-complex in . Proceedings of the National Academy of Sciences of the United States of America. 2018 May 24; . pii:201803283. doi:10.1073/pnas.1803283115. PMID:29794222
Gaballa A, Chi BK, Roberts AA, Becher D, Hamilton CJ, Antelmann H, Helmann JD Redox regulation in Bacillus subtilis: The bacilliredoxins BrxA(YphP) and BrxB(YqiW) function in de-bacillithiolation of S-bacillithiolated OhrR and MetE. Antioxidants & redox signaling. 2014 Jul 20; 21(3):357-67. doi:10.1089/ars.2013.5327. PMID:24313874
Kriel A, Brinsmade SR, Tse JL, Tehranchi AK, Bittner AN, Sonenshein AL, Wang JD GTP dysregulation in Bacillus subtilis cells lacking (p)ppGpp results in phenotypic amino acid auxotrophy and failure to adapt to nutrient downshift and regulate biosynthesis genes. Journal of bacteriology. 2014 Jan; 196(1):189-201. doi:10.1128/JB.00918-13. PMID:24163341
Chi BK, Roberts AA, Huyen TT, Bäsell K, Becher D, Albrecht D, Hamilton CJ, Antelmann H S-bacillithiolation protects conserved and essential proteins against hypochlorite stress in firmicutes bacteria. Antioxidants & redox signaling. 2013 Apr 10; 18(11):1273-95. doi:10.1089/ars.2012.4686. PMID:22938038
Chi BK, Gronau K, Mäder U, Hessling B, Becher D, Antelmann H S-bacillithiolation protects against hypochlorite stress in Bacillus subtilis as revealed by transcriptomics and redox proteomics. Molecular & cellular proteomics : MCP. 2011 Nov; 10(11):M111.009506. doi:10.1074/mcp.M111.009506. PMID:21749987
Chi BK, Gronau K, Mäder U, Hessling B, Becher D, Antelmann H S-bacillithiolation protects against hypochlorite stress in Bacillus subtilis as revealed by transcriptomics and redox proteomics. Molecular & cellular proteomics : MCP. 2011 Nov; 10(11):M111.009506. doi:10.1074/mcp.M111.009506. PMID:21749987
Gutiérrez-Preciado A, Henkin TM, Grundy FJ, Yanofsky C, Merino E Biochemical features and functional implications of the RNA-based T-box regulatory mechanism. Microbiology and molecular biology reviews : MMBR. 2009 Mar; 73(1):36-61. doi:10.1128/MMBR.00026-08. PMID:19258532
Tomsic J, McDaniel BA, Grundy FJ, Henkin TM Natural variability in S-adenosylmethionine (SAM)-dependent riboswitches: S-box elements in bacillus subtilis exhibit differential sensitivity to SAM In vivo and in vitro. Journal of bacteriology. 2008 Feb; 190(3):823-33. . PMID:18039762
Eymann C, Becher D, Bernhardt J, Gronau K, Klutzny A, Hecker M Dynamics of protein phosphorylation on Ser/Thr/Tyr in Bacillus subtilis. Proteomics. 2007 Oct; 7(19):3509-26. . PMID:17726680
Hochgräfe F, Mostertz J, Pöther DC, Becher D, Helmann JD, Hecker M S-cysteinylation is a general mechanism for thiol protection of Bacillus subtilis proteins after oxidative stress. The Journal of biological chemistry. 2007 Sep 07; 282(36):25981-5. . PMID:17611193
Hochgräfe F, Mostertz J, Albrecht D, Hecker M Fluorescence thiol modification assay: oxidatively modified proteins in Bacillus subtilis. Molecular microbiology. 2005 Oct; 58(2):409-25. . PMID:16194229
Eymann C, Dreisbach A, Albrecht D, Bernhardt J, Becher D, Gentner S, Tam le T, Büttner K, Buurman G, Scharf C, Venz S, Völker U, Hecker M A comprehensive proteome map of growing Bacillus subtilis cells. Proteomics. 2004 Oct; 4(10):2849-76. . PMID:15378759
Mäder U, Homuth G, Scharf C, Büttner K, Bode R, Hecker M Transcriptome and proteome analysis of Bacillus subtilis gene expression modulated by amino acid availability. Journal of bacteriology. 2002 Aug; 184(15):4288-95. . PMID:12107147
Grundy FJ, Henkin TM The S box regulon: a new global transcription termination control system for methionine and cysteine biosynthesis genes in gram-positive bacteria. Molecular microbiology. 1998 Nov; 30(4):737-49. . PMID:10094622