yveA

168

similar to aspartate/ glutamate transporter

Locus: BSU_34470

Molecular weight: 56.82 kDa

Isoelectric point: 9.68

Protein length: 520 aa

Gene length: 1563 bp

Function: unknown

Product: similar to aspartate/ glutamate transporter

Essential: no

Synonyms: yveA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0531 (Galperin et al., 2021)

Gene

Coordinates: 3,539,165  3,540,727

The protein

Protein family

• amino acid-polyamine-organocation (APC) superfamily (according to UniProt)

Structure

• 5OQT (PDB) (YneM from E. coli, 28% identity) PubMed
• O07002 (AlphaFold)

Paralogous protein(s)

• AimA

Localization

• cell membrane (according to UniProt)

Additional information

• the protein has been annotated as aspartate transporter. It is, however, not implicated in aspartate uptake in exponentially growing cells PubMed

Expression and Regulation

Operons

• Genes: yveA

  Description: PubMed

  Regulation

  • expressed during sporulation in the forespore (SigG) PubMed

  Regulatory mechanism

  • DegU: activation, DegU-P, PubMed, in degU regulon

  Sigma factors

  • SigG: sigma factor, PubMed, in sigG regulon

Biological materials

Mutant

• GP2385 ∆yveA::cat, available in Jörg Stülke's lab
• GP2795 ∆yveA::spec, available in Jörg Stülke's lab
• GP2822 ∆yveA::neo, available in Jörg Stülke's lab
• GP4154 (ΔgltT::kan) (ΔyveA::cat), available in Jörg Stülke's lab
• BKE34470 (yveA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCGCTTCCTCCTTTGAA,  downstream forward: _UP4_TAAAGAAGCAAGAGGTTTTC
• BKK34470 (yveA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCGCTTCCTCCTTTGAA,  downstream forward: _UP4_TAAAGAAGCAAGAGGTTTTC
• MDB43 (yveA::neo trpC2 pheA1 available in Erhard Bremer's and Jörg Stülke's labs PubMed
• MGNA-B615 (yveA::erm), available at the NBRP B. subtilis, Japan

References

Loading