yuiE

168

similar to leucyl aminopeptidase

Locus: BSU_32050

Molecular weight: 53.49 kDa

Isoelectric point: 4.55

Protein length: 500 aa

Gene length: 1503 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yuiE

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Groups of genes, Poorly characterized/ putative enzymes

List of homologs in different organisms, belongs to COG0260 (Galperin et al., 2021)

Gene

Coordinates: 3,296,417 → 3,297,919

The protein

Catalyzed reaction/ biological activity

Release of an N-terminal amino acid, Xaa-|-Yaa-, in which Xaa is preferably Leu, but may be other amino acids including Pro although not Arg or Lys, and Yaa may be Pro. Amino acid amides and methyl esters are also readily hydrolyzed, but rates on arylamides are exceedingly low (according to UniProt)
Release of an N-terminal amino acid, preferentially leucine, but not glutamic or aspartic acids (according to UniProt)

Protein family

peptidase M17 family (single member, according to UniProt)

Structure

3H8E (PDB) (from Pseudomonas putida 37% identity) PubMed
O32106 (AlphaFold)

Expression and Regulation

Operons

Genes: yuiE

Description: PubMed

Biological materials

Mutant

MGNA-B569 (yuiE::erm), available at the NBRP B. subtilis, Japan
BKE32050 (ΔyuiE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAGGCTTACACTCCTAA,  downstream forward: _UP4_TAATGAAAAATCCCTGCTGT
BKK32050 (ΔyuiE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAGGCTTACACTCCTAA,  downstream forward: _UP4_TAATGAAAAATCCCTGCTGT

References

Research papers

Rojano-Nisimura AM, Miller LG, Anantharaman A, Middleton AT, Kibret E, Jung SH, Russell R, Contreras LMA high-throughput search for intracellular factors that affect RNA folding identifies E. coli proteins PepA and YagL as RNA chaperones that promote RNA remodelling.RNA biology. 2024 Jan; 21(1):13-30. PMID: 39576267
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
de Jong L, Roseboom W, Kramer G A composite filter for low FDR of protein-protein interactions detected by in vivo cross-linking. Journal of proteomics. 2021 Jan 6; 230:103987. PMID: 32949815
Kale A, Pijning T, Sonke T, Dijkstra BW, Thunnissen AM Crystal structure of the leucine aminopeptidase from Pseudomonas putida reveals the molecular basis for its enantioselectivity and broad substrate specificity. Journal of molecular biology. 2010 May 21; 398(5):703-14. doi:10.1016/j.jmb.2010.03.042. PMID:20359484