gbsR

168

transcription repressor of the opuBA-opuBB-opuBC-opuBD and gbsA-gbsB operons

Locus: BSU_31070

Molecular weight: 20.92 kDa

Isoelectric point: 4.62

Protein length: 180 aa

Gene length: 543 bp

Function: regulation of osmoprotection

Product: transcription repressor

Essential: no

Synonyms: gbsR, yuaC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1510 (Galperin et al., 2021)

Gene

Coordinates: 3,186,763  3,187,305

The protein

Catalyzed reaction/ biological activity

• sensing of choline and arsenocholine PubMed
• control of the gbsA-gbsB and opuBA-opuBB-opuBC-opuBD operons PubMed

Protein family

• GbsR family (with OpcR and YvaV, according to UniProt)

Structure

• P71015 (AlphaFold)

Effectors of protein activity

• binds the inducer choline with an apparent K(D) of approximately 165 µMPubMed
• binds the inducer arsenocholine with an apparent K(D) of approximately 2.1 mM PubMed

Expression and Regulation

Operons

• Genes: gbsR

  Description: PubMed

Biological materials

Mutant

• MGNA-A219 (yuaC::erm), available at the NBRP B. subtilis, Japan
• BKE31070 (gbsR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACTGACCCTCTTTTCCT,  downstream forward: _UP4_TAAAGCAGAAAACGCCTGGG
• BKK31070 (gbsR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACTGACCCTCTTTTCCT,  downstream forward: _UP4_TAAAGCAGAAAACGCCTGGG

LacZ fusion

• pGP3876 (cat, based on pAC5]), available in Jörg Stülke's lab
• pGP3877 (kan, based on pAC7]), available in Jörg Stülke's lab

Labs working on this gene/protein

• Erhard Bremer, University of Marburg, Germany homepage

References

Loading