tepA

168

orphan ClpP-like germination protease, contributes to SASP degradation

Locus: BSU_16790

Molecular weight: 24.10 kDa

Isoelectric point: 5.57

Protein length: 245 aa

Gene length: 738 bp

Function: degradation of SASPs

Product: germination protease

Essential: no

Synonyms: tepA, ymfB, ylxI

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Protein synthesis, modification and degradation, Proteolysis, Proteolysis during sporulation/ germination

Lifestyles, Sporulation, Germination, Additional germination proteins

List of homologs in different organisms, belongs to COG0740 (Galperin et al., 2021)

This gene is a member of the following regulons

SigG regulon, SpoVT regulon

Gene

Coordinates: 1,751,201  1,751,938

The protein

Catalyzed reaction/ biological activity

degradation of SASPs in germinating spores PubMed

Protein family

Peptidase S14 family (with ClpP, according to UniProt)

Structure

Q99171 (AlphaFold)

Effectors of protein activity

activity requires YlzJ PubMed

Localization

inner spore membrane PubMed

Expression and Regulation

Operons

Genes: tepA-ylzJ

Description: PubMed

Regulation

expressed late during sporulation in the forespore (SigG, SpoVT) PubMed

Regulatory mechanism

SpoVT: repression, PubMed, in spoVT regulon

Sigma factors

SigG: sigma factor, PubMed, in sigG regulon

Biological materials

Mutant

MGNA-B377 (ymfB::erm), available at the NBRP B. subtilis, Japan
GP1120 (spc), available in Jörg Stülke's lab
BKE16790 (tepA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTCGCTTTCATCCTTTC,  downstream forward: _UP4_AAAGAAGAAGGACGGATGAT
BKK16790 (tepA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTCGCTTTCATCCTTTC,  downstream forward: _UP4_AAAGAAGAAGGACGGATGAT

References

Reviews

Galperin MY, Yutin N, Wolf YI, Vera Alvarez R, Koonin EVConservation and Evolution of the Sporulation Gene Set in Diverse Members of the Firmicutes.Journal of bacteriology. 2022 May 31; :e0007922. PMID: 35638784

Original Publications

Zheng L, Abhyankar W, Ouwerling N, Dekker HL, van Veen H, van der Wel NN, Roseboom W, de Koning LJ, Brul S, de Koster CG Bacillus subtilis Spore Inner Membrane Proteome. Journal of proteome research. 2016 Feb 05; 15(2):585-94. doi:10.1021/acs.jproteome.5b00976. PMID:26731423
Traag BA, Pugliese A, Setlow B, Setlow P, Losick R A conserved ClpP-like protease involved in spore outgrowth in Bacillus subtilis. Molecular microbiology. 2013 Oct; 90(1):160-6. doi:10.1111/mmi.12355. PMID:23927687
Traag BA, Pugliese A, Eisen JA, Losick R Gene conservation among endospore-forming bacteria reveals additional sporulation genes in Bacillus subtilis. Journal of bacteriology. 2013 Jan; 195(2):253-60. doi:10.1128/JB.01778-12. PMID:23123912
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849
Bolhuis A, Matzen A, Hyyryläinen HL, Kontinen VP, Meima R, Chapuis J, Venema G, Bron S, Freudl R, van Dijl JM Signal peptide peptidase- and ClpP-like proteins of Bacillus subtilis required for efficient translocation and processing of secretory proteins. The Journal of biological chemistry. 1999 Aug 27; 274(35):24585-92. . PMID:10455123