ywzB

168

unknown

Locus: BSU_36780

Molecular weight: 8.32 kDa

Isoelectric point: 9.57

Protein length: 76 aa

Gene length: 231 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: ywzB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG4836 (Galperin et al., 2021)

Gene

Coordinates: 3,780,162  3,780,392

The protein

Structure

• O32278 (AlphaFold)

Expression and Regulation

Operons

• Genes: ywzB-spoIIT-murAA

  Description: PubMed

  Regulation

  • expressed early during sporulation in the forespore (SigF) PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigF: sigma factor, PubMed, in sigF regulon

Biological materials

Mutant

• BKE36780 (ywzB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTATTACACTCCTTTCT,  downstream forward: _UP4_TAATAGGTTTTGAACATTAT
• BKK36780 (ywzB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTATTACACTCCTTTCT,  downstream forward: _UP4_TAATAGGTTTTGAACATTAT

References

Galperin MY, Yutin N, Wolf YI, Vera Alvarez R, Koonin EVConservation and Evolution of the Sporulation Gene Set in Diverse Members of the Firmicutes.Journal of bacteriology. 2022 May 31; :e0007922. PMID: 35638784
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849