yrzF

168

putative serine/threonine-protein kinase

Locus: BSU_27785

Molecular weight: 25.00 kDa

Isoelectric point: 9.185

Protein length: 215 aa

Gene length: 648 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yrzF

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Groups of genes, Proteins of unknown function

List of homologs in different organisms, belongs to COG2112 (Galperin et al., 2021)

Gene

Coordinates: 2,840,110 → 2,840,757

The protein

Catalyzed reaction/ biological activity

ATP + L-seryl-[protein] --> ADP + H⁺ + O-phospho-L-seryl-[protein] (according to UniProt)
ATP + L-threonyl-[protein] --> ADP + H⁺ + O-phospho-L-threonyl-[protein] (according to UniProt)

Protein family

protein kinase superfamily (according to UniProt)
Ser/Thr protein kinase family (according to UniProt)

Domains

Protein kinase domain (aa 27-215) (according to UniProt)

Structure

O32057 (AlphaFold)

Expression and Regulation

Operons

Genes: yrzF

Description: PubMed

Biological materials

Mutant

MGNA-B521 (yrzF::erm), available at the NBRP B. subtilis, Japan
BKE27785 (ΔyrzF::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCATTCACCTTCTTTG,  downstream forward: _UP4_TAAATCAAAAAGGCAGCCGC
BKK27785 (ΔyrzF::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCATTCACCTTCTTTG,  downstream forward: _UP4_TAAATCAAAAAGGCAGCCGC