licA

168

lichenan-specific permease of the phosphotransferase system, EIIA of the PTS

Locus: BSU_38570

Molecular weight: 12.04 kDa

Isoelectric point: 4.64

Protein length: 110 aa

Gene length: 333 bp

Function: lichenan uptake and phosphorylation

Product: lichenan-specific PTS, EIIA component

Essential: no

Synonyms: licA, celC

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, Phosphotransferase system, Sugar specific PTS proteins

Metabolism, Carbon metabolism, Utilization of specific carbon sources, Utilization of other polymeric carbohydrates

Groups of genes, Phosphoproteins, Phosphorylation on a His residue

List of homologs in different organisms, belongs to COG1447 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CcpA regulon, LicR regulon

Gene

Coordinates: 3,959,841 → 3,960,173

The protein

Protein family

PTS permease, lactose family PubMed

Domains

PTS EIIA domain type-3 (aa 3-101) (according to UniProt)

Structure

3K1S (PDB) (IIA(Cel) from B. anthracis, 42% identity)
P46319 (AlphaFold)

Paralogous protein(s)

GmuA

Localization

cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

Genes: licB-licC-licA-licH

Description: PubMed

Regulation

carbon catabolite repression (CcpA) PubMed

Regulatory mechanism

CcpA: repression, PubMed, in ccpA regulon
LicR: activation, PubMed, in licR regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

BKE38570 (ΔlicA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATTCACGCGATTCACTTCCT,  downstream forward: _UP4_ACCGAGCAAAGGGGAGCAAG
BKK38570 (ΔlicA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATTCACGCGATTCACTTCCT,  downstream forward: _UP4_ACCGAGCAAAGGGGAGCAAG

References

Nagler K, Krawczyk AO, De Jong A, Madela K, Hoffmann T, Laue M, Kuipers OP, Bremer E, Moeller R Identification of Differentially Expressed Genes during Bacillus subtilis Spore Outgrowth in High-Salinity Environments Using RNA Sequencing. Frontiers in microbiology. 2016; 7:1564. . PMID:27766092
Inaoka T, Satomura T, Fujita Y, Ochi K Novel gene regulation mediated by overproduction of secondary metabolite neotrehalosadiamine in Bacillus subtilis. FEMS microbiology letters. 2009 Feb; 291(2):151-6. doi:10.1111/j.1574-6968.2008.01450.x. PMID:19087206
Tam le T, Eymann C, Albrecht D, Sietmann R, Schauer F, Hecker M, Antelmann H Differential gene expression in response to phenol and catechol reveals different metabolic activities for the degradation of aromatic compounds in Bacillus subtilis. Environmental microbiology. 2006 Aug; 8(8):1408-27. . PMID:16872404
Reizer J, Bachem S, Reizer A, Arnaud M, Saier MH, Stülke J Novel phosphotransferase system genes revealed by genome analysis - the complete complement of PTS proteins encoded within the genome of Bacillus subtilis. Microbiology (Reading, England). 1999 Dec; 145 ( Pt 12):3419-29. . PMID:10627040
Tobisch S, Stülke J, Hecker M Regulation of the lic operon of Bacillus subtilis and characterization of potential phosphorylation sites of the LicR regulator protein by site-directed mutagenesis. Journal of bacteriology. 1999 Aug; 181(16):4995-5003. . PMID:10438772
Tobisch S, Glaser P, Krüger S, Hecker M Identification and characterization of a new beta-glucoside utilization system in Bacillus subtilis. Journal of bacteriology. 1997 Jan; 179(2):496-506. . PMID:8990303
Tobisch S, Glaser P, Krüger S, Hecker M Identification and characterization of a new beta-glucoside utilization system in Bacillus subtilis. Journal of bacteriology. 1997 Jan; 179(2):496-506. . PMID:8990303