yflA

168

general stress protein, similar to amino acid carrier protein, required for protection against paraquat stress

Locus: BSU_07750

Molecular weight: 50.48 kDa

Isoelectric point: 9.86

Protein length: 471 aa

Gene length: 1416 bp

Function: protection against paraquat stress

Product: unknown

Essential: no

Synonyms: yflA

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, Transporters/ other, Amino acid transporters, Alanine or glycine cation symporter family

Cellular processes, Transporters, Transporters/ other, Other transporters

Lifestyles, Coping with stress, General stress proteins (controlled by SigB)

Lifestyles, Coping with stress, Resistance against oxidative and electrophile stress

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG1115 (Galperin et al., 2021)

This gene is a member of the following regulons

SigB regulon, AbrB regulon, Abh regulon

Gene

Coordinates: 844,770  846,185

The protein

Protein family

Alanine or glycine:cation symporter (AGCS) (TC 2.A.25) family (according to UniProt)

Structure

6CSE (PDB) (sodium/alanine symporter from Methanococcus maripaludis S2, 37% identity) PubMed
O34708 (AlphaFold)

Paralogous protein(s)

AlsT, GlnT, YrbD

Localization

cell membrane (according to UniProt)

Expression and Regulation

Operons

Genes: yflA

Description: PubMed

Regulatory mechanism

Abh: repression, in abh regulon
AbrB: repression, in abrB regulon

Sigma factors

SigB: sigma factor, PubMed, in sigB regulon

Genes: yflD-yflB-yflA

Description: PubMed

Regulatory mechanism

AbrB: repression, PubMed, in abrB regulon

Sigma factors

SigB: sigma factor, PubMed, in sigB regulon

Biological materials

Mutant

GP3557 (ΔyflA::phleo), available in Jörg Stülke's lab
MGNA-C257 (yflA::erm), available at the NBRP B. subtilis, Japan
BKE07750 (yflA::erm  trpC2) available at BGSC and in Jörg Stülke's lab,  PubMed, upstream reverse: _UP1_CATCCCATCACCCTTTTTTC,  downstream forward: _UP4_TCCTAGTGTTTTGCTTTTGC
BKK07750 (yflA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCCCATCACCCTTTTTTC,  downstream forward: _UP4_TCCTAGTGTTTTGCTTTTGC

References

Loading