glxB
168
glyoxalase II
locus
BSU_32660
Molecular weight
14.30 kDa
pI
4.61
function
detoxification of methylglyoxal
product
glyoxalase II
essential
no
synonyms
glxB, yurT
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0346 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
3,354,551 3,354,934
The protein
Catalyzed reaction/ biological activity
[metabolite|S-lactoyl-bacillithiol] --> D-[metabolite|lactate] + [metabolite|bacillithiol] [Pubmed|24330391]
Protein family
glyoxalase I family (with [protein|54E05955FF1732F434A0FAB08967573B8DD3ADD2|glxA] and [protein|F02D4AFF60ADDDC5F5B85A3ACCA3AF803560B91E|yraH], according to UniProt)
[wiki|Domains]
[wiki|VOC domain] (aa 1-127) (according to UniProt)
Structure
[PDB|4G6X] (from Catenulispora acidiphila, 53% identity)
[AF|O32161]
Expression and Regulation
Operons
genes
[gene|85E5D3211F27DA64C4E829385C6A08F4A4A2F874|yuzN]-[gene|0A244A61A9A484F0BF083C918AE5A2C6A3F8157E|glxB]
description
[Pubmed|22383849]
Biological materials
Mutant
MGNA-B582 (yurT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1581 NBRP B. subtilis, Japan]
BKE32660 ([gene|0A244A61A9A484F0BF083C918AE5A2C6A3F8157E|glxB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTTTTTCCCTCCTT, downstream forward: _UP4_TAACCGATTCAGTCGCGTCC
BKK32660 ([gene|0A244A61A9A484F0BF083C918AE5A2C6A3F8157E|glxB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTTTTTCCCTCCTT, downstream forward: _UP4_TAACCGATTCAGTCGCGTCC
References
Page visits: 3343
Time of last update: 2025-10-24 10:25:38
Author of last update: Jstuelk