recA

recA
168

multifunctional protein involved in homologous recombination and DNA repair (LexA-autocleavage), required to internalize and to recombine ssDNA with homologous resident duplex, required for efficient survival and replication restart after replication-transcription conflicts, crucial for the acquisition of homologous genes from related species by natural transformation

Locus
BSU_16940
Molecular weight
37.93 kDa
Isoelectric point
4.88
Protein length
Gene length
Function
DNA repair/ recombination
Product
multifunctional protein involved in homologous recombination and DNA repair (LexA-autocleavage)
Essential
no
Synonyms
recA, recE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0468 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,764,645 1,765,691
Phenotypes of a mutant
slower growth PubMed
drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) PubMed
reduced sporulation efficiency PubMed
strongly reduced chromosomal transformation rate PubMed
strongly reduced survival after mitomycin treatment PubMed
no amplification of the gltA-gltB chromosomal region to suppress the glutamate auxotrophy of a gltC mutant PubMed
sensitive to Cr(VI) treatment PubMed
reduced resistance towards electron beams PubMed
reduced viability of a rarA recA double mutant PubMed
suppression of lethality of pcrA inactivation PubMed
a recA rnhC double mutant is not viable PubMed
ATP --> ADP + Pi PubMed
The protein
Catalyzed reaction/ biological activity
RecA stimulates ssDNA phosphorylase activity of PnpA PubMed
RecA-ATP in concert with DprA and SsbA catalyzes DNA strand exchange, with SsbB as an accessory factor PubMed
RecA-dATP catalyzes strand exchange even in the absence of the accessory factors PubMed
protects sporulating cells from DNA damage PubMed
contributes to transfection with naked phage DNA PubMed
RecA polymerized on tailed SPP1 duplex intermediates invades a homologous region in another incomplete molecule, and in concert with RecD2 helicase, reconstitutes a complete linear phage genome with redundant regions at the ends of the molecule PubMed
Protein family
RecA family (together with RadA) (according to UniProt)
Structure
1UBC (PDB) (RecA from Mycobacterium smegmatis, 67% identity) PubMed
Modification
phosphorylated on Arg-58 PubMed
phosphorylated on Ser-2 PubMed by YabT PubMed
Effectors of protein activity
RecO and DprA provide RecA access to ssDNA during chromosomal transformation PubMed
interaction with DisA inhibits RecA filament growth and RecA-mediated DNA strand exchange PubMed
colocalizes to the replisome in response to endogenous and exogenous DNA damage and in response to damage-independent fork arrest (formation of DNA repair centers), repair center formation depends on RecO and RecR, and is facilitated by RecF and SsbA PubMed
Nucleoid (Mid-cell) PubMed
localizes to one cell pole PubMed
co-localizes with the DNA uptake machinery PubMed
forms a transient, mobile focus associated with the chromosome during spore development PubMed
Additional information
belongs to the 100 most abundant proteins PubMed
Expression and Regulation
Operons
Genes
Description
Regulation
induced by conditions that trigger development of genetic competence (ComK) PubMed
expression is induced in the presence of Cr(VI) PubMed
Regulatory mechanism
LexA: repression, PubMed, in lexA regulon
ComK: activation, PubMed, in comK regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

recA

2025-06-11 08:34:16

Jstuelk

152

b5f3c0792ce95f73c71b97dead2eec740cbe7f8a

0F9DC80A650EA38C0E73D576717066E201884262

Biological materials
Mutant
IRN444 (cat), available in Jörg Stülke's lab
GP2542(recA::spc trpC2), available in Jörg Stülke's lab
1A746 (recA::erm), PubMed, available at the Bacillus Genetic Stock Center
1A786 (recA::kan), PubMed, available at the Bacillus Genetic Stock Center
BP469 (recA::erm), available in Fabian Commichau's lab
BKE16940 (''recA::erm'', available in the Bacillus Genetic Stock Center, in Fabian Commichau's, and in Jörg Stülke's labs) PubMed
BKE16940 (recA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
BKK16940 (recA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
Expression vectors
for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Ulf Gerth's lab
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab
Labs working on this gene/protein
Peter Graumann, Freiburg University, Germany homepage
References
Reviews
Loading
Original Publications
Loading

A44D4677FB70BE8F554BF1001A500F817C7DA95F

Page visits: 16131

Time of last update: 2025-06-12 03:59:55

Author of last update: Jstuelk