yqhH

yqhH
168

similar to SNF2 helicase

locus
BSU_24580
Molecular weight
64.50 kDa
pI
8.38
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yqhH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0553 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,549,775  2,551,448
Phenotypes of a mutant
poorly transformable [pubmed|28189581]
The protein
Protein family
[wiki|helicase family] (according to UniProt)
SNF2/RAD54 helicase family (with [protein|265490FA83D6D3F178C26C9240E3CB224513BF42|ywqA], according to UniProt)
[wiki|Domains]
[wiki|Helicase ATP-binding domain] (aa 70-224) (according to UniProt)
[wiki|Helicase C-terminal domain] (aa 363-524) (according to UniProt)
Structure
[PDB|1Z6A] (from Sulfolobus solfataricus, 27% identity) [PDB|15882619]
[AF|P54509]
Expression and Regulation
Operons
genes
[gene|565D91F3E0357C5B16CC342FCDA7EFD4B910829C|yqhH]-[gene|22BEB39F735DAAF71F1B382CD453A9C2D4CC9FA4|yqhG]
description
expressed early during sporulation
regulation
expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]) [Pubmed|16497325]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab

[gene|565D91F3E0357C5B16CC342FCDA7EFD4B910829C|yqhH]→[gene|22BEB39F735DAAF71F1B382CD453A9C2D4CC9FA4|yqhG]

2025-10-17 07:22:09

TPed

104

9F4B346351034DAA39D67C4D419D9D7448F5510C

C4DE4221B97DA07830BB49354F562EAFF2B59DEF

Biological materials
Mutant
MGNA-C418 (yqhH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2416 NBRP B. subtilis, Japan]
BKE24580 ([gene|565D91F3E0357C5B16CC342FCDA7EFD4B910829C|yqhH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTGAAACCGCCTT,  downstream forward: _UP4_TAGCCTGTAAGGAGGTTTTA
BKK24580 ([gene|565D91F3E0357C5B16CC342FCDA7EFD4B910829C|yqhH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTGAAACCGCCTT,  downstream forward: _UP4_TAGCCTGTAAGGAGGTTTTA
References
16497325,28189581,15882619

565D91F3E0357C5B16CC342FCDA7EFD4B910829C

Page visits: 3007

Time of last update: 2025-10-24 10:25:08

Author of last update: Melvin.boenninger