ykoM

168

similar to transcriptional regulator (MarR family)

Locus: BSU_13340

Molecular weight: 17.72 kDa

Isoelectric point: 9.47

Protein length: 154 aa

Gene length: 465 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: ykoM

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Regulation of gene expression, Transcription factors and their control, Transcription factor/ other/ based on similarity

Groups of genes, Phosphoproteins, Phosphorylation on an Arg residue

List of homologs in different organisms, belongs to COG1846 (Galperin et al., 2021)

Gene

Coordinates: 1,398,496  1,398,960

The protein

Domains

HTH marR-type domain (aa 14-146) (according to UniProt)

Structure

3ZPL (PDB) (from Steptomyces coelicolor, corresponds to aa 17 ... 142, 24.6% identity) PubMed
O34949 (AlphaFold)

Paralogous protein(s)

MhqR

Expression and Regulation

Operons

Genes: ykoM

Description: PubMed

Biological materials

Mutant

BKE13340 (ykoM::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATCTACCTCGTATATAG,  downstream forward: _UP4_TTTCGTTAACTATTCTACAC
BKK13340 (ykoM::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATCTACCTCGTATATAG,  downstream forward: _UP4_TTTCGTTAACTATTCTACAC
GP2873 (''ykoM::zeo''), available in Jörg Stülke's lab

References

Research papers

Stevenson CE, Assaad A, Chandra G, Le TB, Greive SJ, Bibb MJ, Lawson DM Investigation of DNA sequence recognition by a streptomycete MarR family transcriptional regulator through surface plasmon resonance and X-ray crystallography. Nucleic acids research. 2013 Aug; 41(14):7009-22. doi:10.1093/nar/gkt523. PMID:23748564