ansB

168

L-aspartase

Locus: BSU_23570

Molecular weight: 52.39 kDa

Isoelectric point: 5.69

Protein length: 475 aa

Gene length: 1428 bp

Function: aspartate degradation

Product: L-aspartase

Essential: no

E.C.: 4.3.1.1

Synonyms: ansB

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Amino acid/ nitrogen metabolism, Utilization of amino acids, Utilization of asparagine/ aspartate

List of homologs in different organisms, belongs to COG1027 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, AnsR regulon

Gene

Coordinates: 2,454,347  2,455,774

The protein

Catalyzed reaction/ biological activity

L-aspartate --> fumarate + NH₄⁺ (according to UniProt)

Protein family

class-II fumarase/aspartase family (with CitG, according to UniProt)

Structure

3R6Q (PDB) (from Bacillus sp. YM55-1, 72% identity, 92% similarity) PubMed
P26899 (AlphaFold)

Paralogous protein(s)

CitG

Expression and Regulation

Operons

Genes: ansA-ansB

Description: PubMed

Regulation

expressed in the presence of asparagine (AnsR) PubMed
expression is reduced in motile cells as compared to non-motile cells PubMed

Regulatory mechanism

AnsR: repression, PubMed, in ansR regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Genes: ansA-ansB-mleN-mleA

Description: PubMed

Regulation

AnsA: expressed in the presence of asparagine (AnsR) PubMed

Expression

expressed in the presence of asparagine (AnsR) PubMed
expression is reduced in motile cells as compared to non-motile cells PubMed

Regulatory mechanism

AnsR: transcription repression, PubMed, in ansR regulon

Biological materials

Mutant

GP1153 (ΔansA-ansB::ermC) available in Jörg Stülke's lab
GP4256 (ΔansA-ansB::cat) available in Jörg Stülke's lab
BKE23570 (ansB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAATCTTTAACCTTCTTT,  downstream forward: _UP4_TAAAATTTGTATAAAATACA
BKK23570 (ansB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAATCTTTAACCTTCTTT,  downstream forward: _UP4_TAAAATTTGTATAAAATACA

LacZ fusion

pGP2274 (in pAC5) (GP2961), available in Jörg Stülke's lab

References

Mardoukhi MSY, Rapp J, Irisarri I, Gunka K, Link H, Marienhagen J, de Vries J, Stülke J, Commichau FMMetabolic rewiring enables ammonium assimilation via a non-canonical fumarate-based pathway.Microbial biotechnology. 2024 Mar; 17(3):e14429. PMID: 38483038
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849
Flórez LA, Gunka K, Polanía R, Tholen S, Stülke J SPABBATS: A pathway-discovery method based on Boolean satisfiability that facilitates the characterization of suppressor mutants. BMC systems biology. 2011 Jan 11; 5:5. doi:10.1186/1752-0509-5-5. PMID:21219666
Fisher SH, Wray LV Bacillus subtilis 168 contains two differentially regulated genes encoding L-asparaginase. Journal of bacteriology. 2002 Apr; 184(8):2148-54. . PMID:11914346
Sun D, Setlow P Cloning and nucleotide sequence of the Bacillus subtilis ansR gene, which encodes a repressor of the ans operon coding for L-asparaginase and L-aspartase. Journal of bacteriology. 1993 May; 175(9):2501-6. . PMID:8478318
Sun DX, Setlow P Cloning, nucleotide sequence, and expression of the Bacillus subtilis ans operon, which codes for L-asparaginase and L-aspartase. Journal of bacteriology. 1991 Jun; 173(12):3831-45. . PMID:1711029
Sun DX, Setlow P Cloning, nucleotide sequence, and expression of the Bacillus subtilis ans operon, which codes for L-asparaginase and L-aspartase. Journal of bacteriology. 1991 Jun; 173(12):3831-45. . PMID:1711029