cheW

168

modulation of CheA activity in response to attractants, scaffold protein

Locus: BSU_16440

Molecular weight: 17.36 kDa

Isoelectric point: 4.42

Protein length: 156 aa

Gene length: 471 bp

Function: control of CheA activity

Product: CheA modulator

Essential: no

Synonyms: cheW

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0835 (Galperin et al., 2021)

Gene

Coordinates: 1,714,855  1,715,325

Phenotypes of a mutant

• ''cheV cheW'' double mutants exhibit complete loss of chemotaxis PubMed
• defective in Swarming motility PubMed

The protein

Domains

• CheW-like domain (aa 8-148) (according to UniProt)

Structure

• 2HO9 (PDB) (from E. coli, 28% identity)
• P39802 (AlphaFold)

Paralogous protein(s)

• CheV, (N-terminal domain of CheV)

Localization

• cytoplasm (according to UniProt)
• predominantly present at the cell poles PubMed

Additional information

• subject to Clp-dependent proteolysis upon glucose starvation PubMed

Expression and Regulation

Operons

• Genes: ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • see fla-che operon

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SwrA: activation, in swrA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

• Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • SwrA: activation, in swrA regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SinR: transcription elongation, binding of the SinR-SlrR heteromer to sites within fliE and fliI results in inhibition of transcription elongation PubMed, in sinR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

Biological materials

Mutant

• BKE16440 (cheW::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTGAGACACCTCCTCGA,  downstream forward: _UP4_GCTTAATCTTAAAGGGGTTA
• BKK16440 (cheW::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTGAGACACCTCCTCGA,  downstream forward: _UP4_GCTTAATCTTAAAGGGGTTA

References

Reviews

Loading

Original Publications

Loading