swrAA/2

168

control of DegU activity, enhances sigD transcription, part of the swrA pseudogene

Locus: BSU_35239

Protein length: 38 aa

Gene length: 117 bp

Function: essential for swarming differentiation on solid surfaces

Product: swarming motility protein

Essential: no

Synonyms: swrAA/2

Genomic Context

Hide small RNAsZoom:

Gene

Coordinates: 3,621,931  3,622,047

Additional information

• in the laboratory strain 168, the swrA gene contains a frameshift mutation (insertion of an extra A in a stretch of eight As), thus the gene is annotated as swrAA/2 (corresponds to the small N-terminal part of the protein) and swrA (corresponds to the large C-terminal part of the protein) PubMed
• the mutation readily reverts giving rise to swarming behaviour PubMed
• the swrA gene is intact in wild type strains such as NCIB3610 PubMed

Expression and Regulation

Operons

• Genes: swrAA/2-minJ

  Description: PubMed

  Regulatory mechanism

  • DegU: activation, DegU-P, (SigA promoter) PubMed, in degU regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

• Genes: swrA-swrAA/2

  Description: PubMed

  Regulatory mechanism

  • DegU: activation, DegU-P, (SigA promoter) PubMed, in degU regulon

  Sigma factors

  • SigD: sigma factor, PubMed, in sigD regulon
  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • SwrA levels are 3 ... 10-fold increased on solid medium as compared to liquid medium (due to LonA/SmiA-mediated degradation of SwrA in liquid medium) PubMed

Biological materials

Mutant

• BKE35239 (swrAA/2::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCTCGCTAACGTTACTC,  downstream forward: _UP4_GGTTCACAATTGAAGAGGGC
• BKK35239 (swrAA/2::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCTCGCTAACGTTACTC,  downstream forward: _UP4_GGTTCACAATTGAAGAGGGC

Labs working on this gene/protein

• see SwrA

References

• see SwrA