gntR

168

transcriptional repressor (GntR family) of the gntR-gntK-gntP-gntZ operon

Locus: BSU_40050

Molecular weight: 28.13 kDa

Isoelectric point: 5.26

Protein length: 243 aa

Gene length: 732 bp

Function: regulation of gluconate utilization

Product: transcriptional repressor of the gluconate operon

Essential: no

Synonyms: gntR

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Carbon metabolism, Utilization of specific carbon sources, Utilization of gluconate

Information processing, Regulation of gene expression, Transcription factors and their control, Transcription factors/ other

List of homologs in different organisms, belongs to COG1802 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CcpA regulon, AbrB regulon, GntR regulon

Gene

Coordinates: 4,113,417  4,114,148

The protein

Protein family

GntR family of transcription factors

Domains

HTH gntR-type domain (aa 17-83) (according to UniProt)

Structure

7U5Q (PDB) (GntR family regulator from Brucella melitensis, corresponding to aa 13 ... 167, 26.9% identity)
P10585 (AlphaFold)

Effectors of protein activity

gluconate acts as molecular inducer

Expression and Regulation

Operons

Genes: gntR-gntK-gntP-gntZ

Description: PubMed

Regulation

induced by gluconate (GntR) PubMed

Regulatory mechanism

GntR: repression, PubMed, in gntR regulon
CcpA: repression, PubMed, in ccpA regulon
AbrB: activation, PubMed, in abrB regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

BKE40050 (gntR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACACTCACCTTCCTCAC,  downstream forward: _UP4_CTGGCAAAAGGAGCTGAATA
BKK40050 (gntR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACACTCACCTTCCTCAC,  downstream forward: _UP4_CTGGCAAAAGGAGCTGAATA

References

Reviews

Capdevila DA, Rondón JJ, Edmonds KA, Rocchio JS, Dujovne MV, Giedroc DPBacterial Metallostasis: Metal Sensing, Metalloproteome Remodeling, and Metal Trafficking.Chemical reviews. 2024 Dec 10; . PMID: 39658019

Original Publications

. . PMID: 220817675
Majidian P, Kuse J, Tanaka K, Najafi H, Zeinalabedini M, Takenaka S, Yoshida KI Bacillus subtilis GntR regulation modified to devise artificial transient induction systems. The Journal of general and applied microbiology. 2017 Jan 25; 62(6):277-285. doi:10.2323/jgam.2016.05.004. PMID:27829583
Marciniak BC, Pabijaniak M, de Jong A, Dűhring R, Seidel G, Hillen W, Kuipers OP High- and low-affinity cre boxes for CcpA binding in Bacillus subtilis revealed by genome-wide analysis. BMC genomics. 2012 Aug 17; 13:401. doi:10.1186/1471-2164-13-401. PMID:22900538
Schumacher MA, Sprehe M, Bartholomae M, Hillen W, Brennan RG Structures of carbon catabolite protein A-(HPr-Ser46-P) bound to diverse catabolite response element sites reveal the basis for high-affinity binding to degenerate DNA operators. Nucleic acids research. 2011 Apr; 39(7):2931-42. doi:10.1093/nar/gkq1177. PMID:21106498
Yoshida K, Ishio I, Nagakawa E, Yamamoto Y, Yamamoto M, Fujita Y Systematic study of gene expression and transcription organization in the gntZ-ywaA region of the Bacillus subtilis genome. Microbiology (Reading, England). 2000 Mar; 146 ( Pt 3):573-9. . PMID:10746760
Miwa Y, Nagura K, Eguchi S, Fukuda H, Deutscher J, Fujita Y Catabolite repression of the Bacillus subtilis gnt operon exerted by two catabolite-responsive elements. Molecular microbiology. 1997 Mar; 23(6):1203-13. . PMID:9106211
Reizer J, Bergstedt U, Galinier A, Küster E, Saier MH, Hillen W, Steinmetz M, Deutscher J Catabolite repression resistance of gnt operon expression in Bacillus subtilis conferred by mutation of His-15, the site of phosphoenolpyruvate-dependent phosphorylation of the phosphocarrier protein HPr. Journal of bacteriology. 1996 Sep; 178(18):5480-6. . PMID:8808939
Fujita Y, Miwa Y, Galinier A, Deutscher J Specific recognition of the Bacillus subtilis gnt cis-acting catabolite-responsive element by a protein complex formed between CcpA and seryl-phosphorylated HPr. Molecular microbiology. 1995 Sep; 17(5):953-60. . PMID:8596444
Yoshida K, Fujita Y, Sarai A Missense mutations in the Bacillus subtilis gnt repressor that diminish operator binding ability. Journal of molecular biology. 1993 May 20; 231(2):167-74. . PMID:8510140
Miwa Y, Fujita Y Promoter-independent catabolite repression of the Bacillus subtilis gnt operon. Journal of biochemistry. 1993 Jun; 113(6):665-71. . PMID:8370661
Fujita Y, Miwa Y Catabolite repression of the Bacillus subtilis gnt operon mediated by the CcpA protein. Journal of bacteriology. 1994 Jan; 176(2):511-3. . PMID:8288545
Yoshida K, Ohmori H, Miwa Y, Fujita Y Bacillus subtilis gnt repressor mutants that diminish gluconate-binding ability. Journal of bacteriology. 1995 Aug; 177(16):4813-6. . PMID:7642511
Yoshida K, Miwa Y, Ohmori H, Fujita Y Analysis of an insertional operator mutation (gntOi) that affects the expression level of the Bacillus subtilis gnt operon, and characterization of gntOi suppressor mutations. Molecular & general genetics : MGG. 1995 Sep 20; 248(5):583-91. . PMID:7476858
Yoshida K, Miwa Y, Ohmori H, Fujita Y Analysis of an insertional operator mutation (gntOi) that affects the expression level of the Bacillus subtilis gnt operon, and characterization of gntOi suppressor mutations. Molecular & general genetics : MGG. 1995 Sep 20; 248(5):583-91. . PMID:7476858
Fujita Y, Fujita T The gluconate operon gnt of Bacillus subtilis encodes its own transcriptional negative regulator. Proceedings of the National Academy of Sciences of the United States of America. 1987 Jul; 84(13):4524-8. . PMID:3037520
Fujita Y, Fujita T, Miwa Y, Nihashi J, Aratani Y Organization and transcription of the gluconate operon, gnt, of Bacillus subtilis. The Journal of biological chemistry. 1986 Oct 15; 261(29):13744-53. . PMID:3020045
Fujita Y, Fujita T, Miwa Y, Nihashi J, Aratani Y Organization and transcription of the gluconate operon, gnt, of Bacillus subtilis. The Journal of biological chemistry. 1986 Oct 15; 261(29):13744-53. . PMID:3020045
Fujita Y, Nihashi J, Fujita T The characterization and cloning of a gluconate (gnt) operon of Bacillus subtilis. Journal of general microbiology. 1986 Jan; 132(1):161-9. . PMID:3011959
Miwa Y, Fujita Y Purification and characterization of a repressor for the Bacillus subtilis gnt operon. The Journal of biological chemistry. 1988 Sep 15; 263(26):13252-7. . PMID:2843515
Fujita Y, Miwa Y Identification of an operator sequence for the Bacillus subtilis gnt operon. The Journal of biological chemistry. 1989 Mar 05; 264(7):4201-6. . PMID:2492998
Fujita Y, Fujita T Identification and nucleotide sequence of the promoter region of the Bacillus subtilis gluconate operon. Nucleic acids research. 1986 Feb 11; 14(3):1237-52. . PMID:2419835
Fujita Y, Fujita T, Miwa Y Evidence for posttranscriptional regulation of synthesis of the Bacillus subtilis Gnt repressor. FEBS letters. 1990 Jul 02; 267(1):71-4. . PMID:2163901
Miwa Y, Fujita Y Determination of the cis sequence involved in catabolite repression of the Bacillus subtilis gnt operon; implication of a consensus sequence in catabolite repression in the genus Bacillus. Nucleic acids research. 1990 Dec 11; 18(23):7049-53. . PMID:2124676
Reizer A, Deutscher J, Saier MH, Reizer J Analysis of the gluconate (gnt) operon of Bacillus subtilis. Molecular microbiology. 1991 May; 5(5):1081-9. . PMID:1659648