putR

168

transcriptional activator of the proline utilization operon putB-putC-putP

Locus: BSU_03230

Molecular weight: 47.67 kDa

Isoelectric point: 5.37

Protein length: 411 aa

Gene length: 1236 bp

Function: regulation of proline utilization

Product: transcriptional activator (PucR family)

Essential: no

Synonyms: putR, ycgP, prcR

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Amino acid/ nitrogen metabolism, Utilization of amino acids, Utilization of proline

Information processing, Regulation of gene expression, Transcription factors and their control, Transcription factors/ other

List of homologs in different organisms, belongs to COG2508 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, PutR regulon

Gene

Coordinates: 348,724 → 349,959

Phenotypes of a mutant

no growth with proline as single source of carbon or nitrogen PubMed

The protein

Catalyzed reaction/ biological activity

transcription activation of the proline utilization operon ''putB-putC-putP'' in the presence of proline  PubMed

Protein family

PucR family
CdaR family (according to UniProt)

Cofactors

proline acts as co-activator  PubMed

Structure

P94393 (AlphaFold)

Effectors of protein activity

proline activates PutR  PubMed

Expression and Regulation

Operons

Genes: putR

Description: PubMed

Regulation

constitutively expressed PubMed

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

BKE03230 (ΔputR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACCTTTTTCTCCTATAC,  downstream forward: _UP4_TAAAAAAGAAACCAGTACTT
BKK03230 (ΔputR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACCTTTTTCTCCTATAC,  downstream forward: _UP4_TAAAAAAGAAACCAGTACTT

References

Loading