yusV

168

ABC transporter for the siderophores Fe-enterobactin and Fe-bacillibactin, as well as for the siderophores schizokinen and arthrobactin (ATP-binding protein)

Locus: BSU_32940

Molecular weight: 30.34 kDa

Isoelectric point: 5.32

Protein length: 275 aa

Gene length: 828 bp

Function: acquisition of iron

Product: ABC transporter for the siderophores Fe-enterobactin, Fe-bacillibactin, schizokinen and arthrobactin  (ATP-binding protein)

Essential: no

Synonyms: yusV

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1120 (Galperin et al., 2021)

Gene

Coordinates: 3,379,112  3,379,939

Phenotypes of a mutant

• severe growth inhibition upon addition of subinhibitory concentrations of mirubactin C PubMed

The protein

Catalyzed reaction/ biological activity

• ATPase for the FeuA-FeuB-FeuC siderophore ABC transporter and for the YfhA-YfiY-YfiZ siderophore ABC transporter

Protein family

• ABC transporter superfamily (according to UniProt)

Domains

• ABC transporter domain (aa 6-242) (according to UniProt)

Structure

• 4R9U (PDB), the E. coli BtuC-BtuD complex, BtuD shares 32% identity, 57% similarity with YusV, PubMed
• O32188 (AlphaFold)

Paralogous protein(s)

• FhuC, FecF, FpbP

Localization

• associated to the membrane (via FeuB-FeuC and YfhA-YfiZ) PubMed

Expression and Regulation

Operons

• Genes: yusV-yusU

  Description: PubMed

  Regulatory mechanism

  • Fur: repression, PubMed, in fur regulon

Biological materials

Mutant

• MGNA-B599 (yusV::erm), available at the NBRP B. subtilis, Japan
• BKE32940 (yusV::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAACCGCTCCTTTTTGCT,  downstream forward: _UP4_TAAATAACGCAGCGAAGGAG
• BKK32940 (yusV::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAACCGCTCCTTTTTGCT,  downstream forward: _UP4_TAAATAACGCAGCGAAGGAG

References

Loading