phoC

phoC
168

[wiki|HAD superfamily] sugar phosphate phosphatase, dephosphorylation of N-acetyl-glucosamine 6-phosphate

locus
BSU_36290
Molecular weight
31.80 kDa
pI
4.88
Protein length
Gene length
function
detoxification of sugar phosphates
product
sugar phosphate phosphatase
essential
no
synonyms
phoC, ywpJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0561 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,738,343 → 3,739,200
The protein
Catalyzed reaction/ biological activity
dephosphorylates glycerol 3-phosphate and ribose 5- phosphate [pubmed|30782637]
dephosphorylation of N-acetyl-glucosamine 6-phosphate [pubmed|32965679]
Protein family
[wiki|HAD superfamily] (according to UniProt)
[wiki|Cof family] (according to UniProt)
[wiki|Cofactors]
Mg2+ [pubmed|30782637]
Structure
[PDB|1NRW]
[AF|P94592]
Modification
phosphorylated on Arg-258 [Pubmed|22517742]
Expression and Regulation
Operons
genes
[gene|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]-[gene|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|phoC]
description
[Pubmed|30782637,22383849]
regulation
induced by phosphosugar stress [Pubmed|30782637]
regulatory mechanism
[protein|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]: repression, [pubmed|30782637], in [regulon|protein:6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|30782637], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]→[gene|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|phoC]

2025-10-09 16:25:45

Jstuelk

107

8dee298a8a3956d4d162cc157c6929049cd30def

B3796EA6F73FC0EC1853F7DDC479F8A5EED92723

Biological materials
Mutant
MGNA-A531 (ywpJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/531 NBRP B. subtilis, Japan]
BKE36290 (Δ[gene|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|phoC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCGCAATTAATTTCACGT,  downstream forward: _UP4_TAAGTATATGTGCTGCCACA
BKK36290 (Δ[gene|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|phoC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK36290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCGCAATTAATTTCACGT,  downstream forward: _UP4_TAAGTATATGTGCTGCCACA
References
22383849,22517742,30782637,32965679

AF9523D3AA3C032B70175BCFFED34E9A42ED01AF

Page visits: 4086

Time of last update: 2025-10-25 22:33:44

Author of last update: Jstuelk