flgM

168

anti-SigD, regulation of flagellin, Motility and chemotaxis

Locus: BSU_35430

Molecular weight: 9.86 kDa

Isoelectric point: 9.92

Protein length: 88 aa

Gene length: 267 bp

Function: control of SigD activity

Product: anti-SigD

Essential: no

Synonyms: flgM

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Regulation of gene expression, Sigma factors and their control, Control of sigma factors

Lifestyles, Exponential and early post-exponential lifestyles, Motility and chemotaxis, Signal transduction in motility and chemotaxis, Additional chemotaxis signal transduction and regulatory proteins

Lifestyles, Exponential and early post-exponential lifestyles, Swarming

Groups of genes, Secreted proteins

List of homologs in different organisms, belongs to COG2747 (Galperin et al., 2021)

Gene

Coordinates: 3,640,285 → 3,640,551

Phenotypes of a mutant

defective in Swarming motility PubMed

The protein

Protein family

flgM family (single member, according to UniProt)

Structure

1RP3 (PDB) (SigD-FlgM complex from Aqufex aeolicus, 34% identity) PubMed
P39809 (AlphaFold)

Localization

secreted and extracellularly degraded by the proteases Epr and WprA PubMed
secretion of FlgM requires the FliF/FliG basal body proteins, the flagellar type III export apparatus components FliO, FliP, FliQ, FliR, FlhA, and FlhB, and the substrate specificity switch regulator FliK PubMed

Expression and Regulation

Operons

Genes: comFA-comFB-comFC-yvyF-flgM-flgN-flgK-flgL-yviE-fliW-csrA

Description: PubMed

Expression

expression is heterogeneous PubMed

Regulatory mechanism

ComK: activation, PubMed, in comK regulon
DegU: activation, DegU-P, PubMed, in degU regulon
ScoC: repression, PubMed, in scoC regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Genes: flgM-flgN-flgK-flgL

Description: PubMed

Sigma factors

SigD: sigma factor, PubMed, in sigD regulon

Genes: yvyF-flgM-flgN-flgK-flgL

Description: PubMed

Biological materials

Mutant

1A764 (no resistance), PubMed, available at BGSC
BKE35430 (ΔflgM::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGGATTCCTCTCGCTTT,  downstream forward: _UP4_AAGCAATAAAAAAGGAGAAA
BKK35430 (ΔflgM::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGGATTCCTCTCGCTTT,  downstream forward: _UP4_AAGCAATAAAAAAGGAGAAA

References

Reviews

Loading

Original Publications

Loading