ysmA

168

similar to thioesterase

Locus: BSU_28420

Molecular weight: 16.93 kDa

Isoelectric point: 5.54

Protein length: 147 aa

Gene length: 444 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: ysmA

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Groups of genes, Proteins of unknown function

List of homologs in different organisms, belongs to COG0824 (Galperin et al., 2021)

Gene

Coordinates: 2,905,067  2,905,510

The protein

Structure

2OIW (PDB) (from B. stearothermophilus, 28% identity)
P11469 (AlphaFold)

Biological materials

Mutant

MGNA-B010 (ysmA::erm), available at the NBRP B. subtilis, Japan
BKE28420 (ysmA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTTTTTTCATCTCCTTA,  downstream forward: _UP4_TAAACTAATTATCTTGTAAA
BKK28420 (ysmA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTTTTTTCATCTCCTTA,  downstream forward: _UP4_TAAACTAATTATCTTGTAAA