ylmE

ylmE
168

pyridoxal phosphate-binding protein, involved in controlling the availability of coenzyme A

locus
BSU_15380
Molecular weight
25.56 kDa
pI
5.55
Protein length
Gene length
function
control of the CoA pool
product
pyridoxal phosphate-binding protein
essential
no
synonyms
ylmE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0325 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,610,170  1,610,862
The protein
Catalyzed reaction/ biological activity
while the protein was described as an amino acid racemase important for biofilm formation [Pubmed|20431016], no racemase activity was detected in ''in vitro'' assays with a functionally active protein [Pubmed|24097949]
Protein family
pyridoxal phosphate-binding protein YggS/PROSC family (single member, according to UniProt)
[wiki|Cofactors]
pyridoxal phosphate [Pubmed|24097949]
Structure
[PDB|1W8G] (the structure of YggS from ''E. coli'' 33% identity, 61% similarity)
[AF|O31727]
Expression and Regulation
Operons
genes
[gene|ECCE99438DBFC52DA7236CB4F6486DD004CADF73|ylmD]-[gene|31789A170CB624BF8210C915F40007F802F5C81B|ylmE]-[gene|DB09F1C36257F511A84A083967A25A9D46744D14|sepF]-[gene|2B2D285D5A8F160808A21DCF07BDB924365970C5|ylmG]-[gene|BD5ACF930DD63E258D71569326752C9A1D7B9324|ylmH]
description
[Pubmed|16420366]
regulation
repressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
Open in new tab

[gene|ECCE99438DBFC52DA7236CB4F6486DD004CADF73|ylmD]→[gene|BD5ACF930DD63E258D71569326752C9A1D7B9324|ylmH]

2025-10-27 13:18:10

ghost

167

d444960f93629c61035f6c91fd3ada83c687ea2d

12299F7737A00124F5303235F9BC3A294A212ACF

Biological materials
Mutant
MGNA-B363 (ylmE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1362 NBRP B. subtilis, Japan]
BKE15380 ([gene|31789A170CB624BF8210C915F40007F802F5C81B|ylmE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTATCAACAACACGCAAGA,  downstream forward: _UP4_AATGAAACAGGGGGTGTACA
BKK15380 ([gene|31789A170CB624BF8210C915F40007F802F5C81B|ylmE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTATCAACAACACGCAAGA,  downstream forward: _UP4_AATGAAACAGGGGGTGTACA
References
14651647,16420366,24097949,26872910,30902856,32900832

31789A170CB624BF8210C915F40007F802F5C81B

Page visits: 5300

Time of last update: 2025-10-28 21:25:16

Author of last update: Jstuelk