ricF

168

subunit of the regulatory iron-sulfur containing RicA-RicF-RicT complex, required for handing over of RicT to RNase Y to facilitate maturation of polycistronic mRNAs, antagonist of biofilm repression by SinR, control of the phosphorelay

Locus: BSU_14990

Molecular weight: 16.77 kDa

Isoelectric point: 5.01

Protein length: 149 aa

Gene length: 450 bp

Function: control of RNase Y activity, see Targets of the Y complex

Product: subunit of the regulatory iron-sulfur containing RicA-RicF-RicT complex

Essential: no

Synonyms: ylbF

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG3679 (Galperin et al., 2021)

Gene

Coordinates: 1,568,420  1,568,869

Phenotypes of a mutant

• strongly reduced genetic competence, strongly reduced sporulation PubMed
• defective in RNase Y-mediated maturation of polycistronic mRNAs, see Targets of the Y complex PubMed
• defective in Swarming motility (prolonged period of immotility prior to Swarming) PubMed

The protein

Catalyzed reaction/ biological activity

• the RicA-RicF-RicT complex acts as specificity factor for RNase Y-dependent processing of polycistronic mRNAs, see Targets of the Y complex PubMed
• the RicA-RicF-RicT complex stimulates Spo0A phosphorylation in the phosphorelay PubMed

Cofactors

• one 4Fe-4S cluster (contributes to the co-ordination of the cluster (with RicA and RicT)) PubMed

Structure

• 6PRK (PDB) (the RicA-RicF complex) PubMed
• O34412 (AlphaFold)

Localization

• cytoplasm PubMed

Expression and Regulation

Operons

• Genes: ricF

  Description: PubMed

• Genes: ricF-ylbG-ylbH-coaD

  Description: PubMed

Additional information

• 7,000/ 340 molecules per cell during growth in LB/ minimal medium PubMed

Biological materials

Mutant

• BKE14990 (ricF::erm  trpC2) available at BGSC and in Jörg Stülke's lab, PubMed, upstream reverse: _UP1_CATAACATGCACCTCCAGTT,  downstream forward: _UP4_TGACGAGACTGGCCGTCTCG
• BKK14990 (ricF::kan  trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAACATGCACCTCCAGTT,  downstream forward: _UP4_TGACGAGACTGGCCGTCTCG

References

Reviews

Loading

Original Publications

Loading