dgkB

168

diacylglycerol kinase

Locus: BSU_06720

Molecular weight: 33.18 kDa

Isoelectric point: 5.64

Protein length: 303 aa

Gene length: 912 bp

Function: biosynthesis of lipoteichoic acid

Product: diacylglycerol kinase

Essential: no

E.C.: 2.7.1.107

Synonyms: dgkB, yerQ, dagK

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell wall synthesis, Biosynthesis of lipoteichoic acid

Metabolism, Additional metabolic pathways, Biosynthesis of cell wall components, Biosynthesis of lipoteichoic acid

List of homologs in different organisms, belongs to COG1597 (Galperin et al., 2021)

Gene

Coordinates: 736,436  737,347

Phenotypes of a mutant

the mutant tends to acquire suppressor mutations that result in improved growth PubMed
essential PubMed, non-essential according to PubMed

The protein

Catalyzed reaction/ biological activity

1,2-diacyl-sn-glycerol + ATP --> 1,2-diacyl-sn-glycero-3-phosphate + ADP + H⁺ (according to UniProt)

Protein family

diacylglycerol/lipid kinase family (with BmrU and YtlR, according to UniProt)

Domains

DAGKc domain (aa 1-132) (according to UniProt)

Structure

3S40 (PDB) (from B. anthracis, 32% identity, 68% similarity)
O31502 (AlphaFold)

Paralogous protein(s)

BmrU

Expression and Regulation

Operons

Genes: dgkB-rlmCD

Description: PubMed

Genes: dgkB-rlmCD-yefC-dnmA-yeeB-yeeC

Description: PubMed

Biological materials

Mutant

MGNA-B448 (yerQ::erm), available at the NBRP B. subtilis, Japan
GP1391 dgkB::cat ltaS::aphA3, available in Jörg Stülke's lab
BKE06720 (dgkB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTATCTCATCATCCTACT,  downstream forward: _UP4_TAAAACTTGGCTTGGTAAGC
BKK06720 (dgkB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTATCTCATCATCCTACT,  downstream forward: _UP4_TAAAACTTGGCTTGGTAAGC

References

Reviews

Percy MG, Gründling A Lipoteichoic acid synthesis and function in gram-positive bacteria. Annual review of microbiology. 2014; 68:81-100. doi:10.1146/annurev-micro-091213-112949. PMID:24819367

Original Publications

Koo BM, Kritikos G, Farelli JD, Todor H, Tong K, Kimsey H, Wapinski I, Galardini M, Cabal A, Peters JM, Hachmann AB, Rudner DZ, Allen KN, Typas A, Gross CA Construction and Analysis of Two Genome-Scale Deletion Libraries for Bacillus subtilis. Cell systems. 2017 Mar 22; 4(3):291-305.e7. pii:S2405-4712(16)30447-1. doi:10.1016/j.cels.2016.12.013. PMID:28189581
Matsuoka S, Hashimoto M, Kamiya Y, Miyazawa T, Ishikawa K, Hara H, Matsumoto K The Bacillus subtilis essential gene dgkB is dispensable in mutants with defective lipoteichoic acid synthesis. Genes & genetic systems. 2011; 86(6):365-76. . PMID:22451476
Jerga A, Lu YJ, Schujman GE, de Mendoza D, Rock CO Identification of a soluble diacylglycerol kinase required for lipoteichoic acid production in Bacillus subtilis. The Journal of biological chemistry. 2007 Jul 27; 282(30):21738-45. . PMID:17535816