tmrB

168

tunicamycin resistance protein, ATP-binding membrane protein

Locus: BSU_03140

Molecular weight: 22.58 kDa

Isoelectric point: 9.71

Protein length: 197 aa

Gene length: 594 bp

Function: resistance to tunicamycin

Product: tunicamycin resistance protein

Essential: no

Synonyms: tmrB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms

Gene

Coordinates: 339,156 → 339,749

The protein

Structure

• 2VLI (PDB) (from Deinococcus radiodurans, 39% identity) PubMed
• P12921 (AlphaFold)

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: tmrB

  Description: (according to DBTBS) null

Biological materials

Mutant

• BKE03140 (ΔtmrB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCGCCATTTCTCCCTTCC,  downstream forward: _UP4_TAAAGCTTCTGTACACGACA
• BKK03140 (ΔtmrB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCGCCATTTCTCCCTTCC,  downstream forward: _UP4_TAAAGCTTCTGTACACGACA

References

Kapp U, Macedo S, Hall DR, Leiros I, McSweeney SM, Mitchell E Structure of Deinococcus radiodurans tunicamycin-resistance protein (TmrD), a phosphotransferase. Acta crystallographica. Section F, Structural biology and crystallization communications. 2008 Jun 01; 64(Pt 6):479-86. doi:10.1107/S1744309108011822. PMID:18540055
Noda Y, Yoda K, Takatsuki A, Yamasaki M TmrB protein, responsible for tunicamycin resistance of Bacillus subtilis, is a novel ATP-binding membrane protein. Journal of bacteriology. 1992 Jul; 174(13):4302-7. . PMID:1624425