yabR

168

similar to the C-terminal domain of E. coli polyribonucleotide phosphorylase and to four repeated domains at the N-terminus of E. coli ribosomal protein S1

Locus: BSU_00630

Molecular weight: 14.05 kDa

Isoelectric point: 10.34

Protein length: 128 aa

Gene length: 387 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yabR

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Lifestyles, Exponential and early post-exponential lifestyles, Swarming

Groups of genes, Strongly expressed understudied proteins, Potential RNA/ Ribosome-binding proteins

Groups of genes, Proteins of unknown function

List of homologs in different organisms, belongs to COG1098 (Galperin et al., 2021)

This gene is a member of the following regulons

SigE regulon, SigM regulon, SigW regulon, SigD regulon, SigX regulon

Gene

Coordinates: 69,626  70,012

Phenotypes of a mutant

defective in Swarming motility PubMed

The protein

Protein family

Peptidase U57 family (together with YabG) (according to UniProt)

Domains

S1 domain (aa 4 ... 74) (according to the Interpro database)

Structure

2K4K (PDB) (YugI, 51% identity from aa 3 ... 91) PubMed
P37560 (AlphaFold)

Paralogous protein(s)

YugI, Array

Expression and Regulation

Operons

Genes: yabM-yabN-rqcP-yabP-shfA-divIC-yabR

Description: PubMed

Regulation

expressed during sporulation (SigE) PubMed

Sigma factors

SigM: sigma factor, PubMed, in sigM regulon
SigE: sigma factor, PubMed, in sigE regulon
SigW: sigma factor, PubMed, in sigW regulon
SigD: sigma factor, PubMed, in sigD regulon
SigX: sigma factor, PubMed, in sigX regulon

Genes: yabP-shfA-divIC-yabR

Description: PubMed

Regulation

expressed during sporulation (SigE) PubMed

Additional information

there are about 50,000 molecules of DivIC per cell PubMed

Genes: divIC-yabR

Description: PubMed

Regulation

expressed during sporulation (SigE) PubMed and under stress conditions

Additional information

there are about 50,000 molecules of DivIC per cell PubMed

Biological materials

Mutant

GP3598 (ΔyabR::kan), available in Jörg Stülke's lab
GP3309 (ΔyugI::tet) (ΔyabR::aphA3), available in Jörg Stülke's lab
GP3314 (yabR-FLAG spec), available in Jörg Stülke's lab
GP3315 (yabR-His spec), available in Jörg Stülke's lab
MGNA-B919 (yabR::erm), available at the NBRP B. subtilis, Japan
BKE00630 (yabR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC,  downstream forward: _UP4_TAACTTGCTGCTTTCTATAA
BKK00630 (yabR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC,  downstream forward: _UP4_TAACTTGCTGCTTTCTATAA

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

LacZ fusion

GP3327 (based on pAC5) available in Jörg Stülke's lab

References

Reviews

Loading

Original Publications

Loading