sigV

168

RNA polymerase ECF-type sigma factor SigV, required for resistance to lytic enzymes

Locus: BSU_27120

Molecular weight: 19.57 kDa

Isoelectric point: 9.04

Protein length: 166 aa

Gene length: 501 bp

Function: resistance to lytic enzymes

Product: RNA polymerase ECF-type sigma factor SigV

Essential: no

Synonyms: sigV

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1595 (Galperin et al., 2021)

Gene

Coordinates: 2,769,850 → 2,770,350

Phenotypes of a mutant

• increased sensitivity to lysozyme, this can be suppressed by overexpression of'' oatA'' PubMed

The protein

Protein family

• Sigma-70 factor family (according to UniProt)
• ECF subfamily (according to UniProt)

Structure

• 5WUQ (PDB) (the SigW-RsiW complex, 28% identity for SigV) PubMed
• O05404 (AlphaFold)

Effectors of protein activity

• activity is controlled by the interaction with RsiV, proteolytic degradation of RsiV releases active SigV PubMed

Additional information

• Expression of the SigV regulon in increased in ''ugtP'' mutants PubMed

Expression and Regulation

Operons

• Genes: sigV-rsiV-oatA-yrhK

  Description: PubMed

  Regulation

  • induced by lysozyme (SigV) PubMed

  Sigma factors

  • SigV: sigma factor, PubMed, in sigV regulon

  Additional information

  • A ncRNA (RnaC) is encoded between 'yrhK' and 'yrhJ' PubMed

Additional information

• activation occurs heterogeneously in individual cells during lysozyme stress PubMed

Biological materials

Mutant

• MGNA-A144 (sigV::erm), available at the NBRP B. subtilis, Japan
• 1A907 ( sigV::kan), PubMed, available at BGSC
• BKE27120 (ΔsigV::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGCAATAAAGGGCTCCT,  downstream forward: _UP4_TTGACGAAGGAGGATCTTTC
• BKK27120 (ΔsigV::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGCAATAAAGGGCTCCT,  downstream forward: _UP4_TTGACGAAGGAGGATCTTTC

Labs working on this gene/protein

• Thomas Wiegert, University of Bayreuth, Germany Wiegert-Dateien/Thomas Wiegert.html Homepage

References

Reviews

Loading

Original Publications

Loading