ahpT
168
thiol disulfide oxidoreductase, reduces [protein|B283B702D917E310130BC33A40BF6A5853C3D4C1|ahpA]
locus
BSU_14230
Molecular weight
17.66 kDa
pI
6.33
function
protection of proteins against oxidative damage
product
thiol disulfide oxidoreductase
essential
no
synonyms
ahpT, ykuV
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0526 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
1,492,875 1,493,321
The protein
[wiki|Domains]
[wiki|Thioredoxin domain] (aa 2-145) (according to UniProt)
Structure
[PDB|2B5X] (reduced form), [PDB|2B5Y] (oxidized form)
[AF|O31699]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|B283B702D917E310130BC33A40BF6A5853C3D4C1|ahpA]-[gene|398E6FAC317D9BD81FB80A7CC9DF1CC757F2FA98|ahpT]
description
[Pubmed|20817675]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Biological materials
Mutant
GP1729 [gene|search|ahpAT]::kan trpC2 available in [wiki|Jörg Stülke]'s lab
MGNA-B344 (ykuV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1343 NBRP B. subtilis, Japan]
BKE14230 ([gene|398E6FAC317D9BD81FB80A7CC9DF1CC757F2FA98|ahpT]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCCTCCTAT, downstream forward: _UP4_TAGGTATCTGACTAAATAGT
BKK14230 ([gene|398E6FAC317D9BD81FB80A7CC9DF1CC757F2FA98|ahpT]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCCTCCTAT, downstream forward: _UP4_TAGGTATCTGACTAAATAGT
References
Page visits: 3667
Time of last update: 2025-10-24 02:57:27
Author of last update: Melvin.boenninger