yraG
168
forespore-specific sporulation protein,similar to spore coat protein
locus
BSU_26950
Molecular weight
9.07 kDa
pI
4.75
function
unknown
product
unknown
essential
no
ec
null
synonyms
yraG
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG5896 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
2,752,802 2,753,047
The protein
Protein family
[wiki|CotF family] (according to UniProt)
Structure
[AF|O07919]
Expression and Regulation
Operons
genes
[gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]-[gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]-[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]-[gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]-[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Biological materials
Mutant
BKE26950 ([gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATGTAACCTCCTT, downstream forward: _UP4_AATTGAAAGGGAGGTAAGCC
BKK26950 ([gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATGTAACCTCCTT, downstream forward: _UP4_AATTGAAAGGGAGGTAAGCC
References
Page visits: 2920
Time of last update: 2025-10-29 08:52:38
Author of last update: Melvin.boenninger