ylxF

168

unknown

Locus: BSU_16260

Molecular weight: 22.80 kDa

Isoelectric point: 9.74

Protein length: 204 aa

Gene length: 615 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: ylxF

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG3334 (Galperin et al., 2021)

Gene

Coordinates: 1,697,651 → 1,698,265

Phenotypes of a mutant

• defective in Swarming motility PubMed

The protein

Structure

• P23454 (AlphaFold)

Expression and Regulation

Operons

• Genes: ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • see fla-che operon

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SwrA: activation, in swrA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

• Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • SwrA: activation, in swrA regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SinR: transcription elongation, binding of the SinR-SlrR heteromer to sites within fliE and fliI results in inhibition of transcription elongation PubMed, in sinR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

Biological materials

Mutant

• MGNA-B103 (ylxF::erm), available at the NBRP B. subtilis, Japan
• BKE16260 (ΔylxF::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TTTGCCGGACATTACATTCG,  downstream forward: _UP4_AGCCAAGAATAGGGGGAATG
• BKK16260 (ΔylxF::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TTTGCCGGACATTACATTCG,  downstream forward: _UP4_AGCCAAGAATAGGGGGAATG

LacZ fusion

• pGP1088 (in pAC6), available in Stülke lab

References

Loading