ftsE

168

ABC transporter (ATP-binding protein) (FtsE-FtsX), required for CwlO activity (cell elongation) and for proper activation of Spo0A and initiation of sporulation

Locus: BSU_35260

Molecular weight: 25.47 kDa

Isoelectric point: 8.42

Protein length: 228 aa

Gene length: 687 bp

Function: control of cell wall synthesis

Product: ABC transporter (ATP-binding protein)

Essential: no

Synonyms: ftsE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2884 (Galperin et al., 2021)

Gene

Coordinates: 3,624,821  3,625,507

Phenotypes of a mutant

• the mutant tends to acquire suppressor mutations that result in improved growth PubMed
• a ''ftsE mutation is synthetically lethal with a lytE'' mutation (due to a lack of autolysin activity) PubMed
• shorter, fatter cells, this can be rescued by addition of Mg(2+) PubMed
• the mutant cells are thicker and shorter than wild type cells PubMed
• reduced growth rate, especially at low Mg(2+) concentrations PubMed
• defective in Swarming motility (periodic cessation and reinitiation of Swarming motility, terracing colonies) PubMed
• poor growth of a ltaS ftsE double mutant PubMed

The protein

Catalyzed reaction/ biological activity

• necessary for the autolysin activity of CwlO PubMed

Protein family

• ABC transporter superfamily (according to UniProt)

Domains

• ABC transporter domain (aa 2-227) (according to UniProt)

Structure

• 3TIF (PDB) (ATP-binding protein from Methanococcus jannaschii, 40% identity) PubMed
• O34814 (AlphaFold)

Paralogous protein(s)

• YknY, YtrE, YxdL, PsdA, YvrO

Localization

• membrane associated (via FtsX) PubMed

Expression and Regulation

Operons

• Genes: ftsE-ftsX

  Description: (according to DBTBS) null

  Regulation

  • repressed under conditions that trigger sporulation (Spo0A) PubMed

  Regulatory mechanism

  • Spo0A: repression, PubMed, in spo0A regulon

Biological materials

Mutant

• BKE35260 (ftsE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAAATCACCTAATCTTT,  downstream forward: _UP4_GAGTCAAGAGGGGAGTATGG
• BKK35260 (ftsE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAAATCACCTAATCTTT,  downstream forward: _UP4_GAGTCAAGAGGGGAGTATGG

References

Reviews

Loading

Original Publications

Loading