sinR

168

transcriptional regulator (Xre family) of post-exponential-phase responses genes

Locus: BSU_24610

Molecular weight: 12.85 kDa

Isoelectric point: 7.18

Protein length: 111 aa

Gene length: 336 bp

Function: control of biofilm formation

Product: transcriptional regulator (Xre family)

Essential: no

Synonyms: sinR, sin, flaD

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1396 (Galperin et al., 2021)

Gene

Coordinates: 2,552,653  2,552,988

Phenotypes of a mutant

• the mutation suppresses the galactose toxicity to a galE mutant  PubMed

Additional information

• the sinR gene is often inactivated during adaptation to Arabidopsis thaliana PubMed
• improved colonization on plant roots (inactivating mutations appear during growth on roots) PubMed

The protein

Catalyzed reaction/ biological activity

• transcription regulator of biofilm genes, acts as a true repressor of the ''tapA-sipW-tasA'' operon and as an anti-activator (prevents binding of the activator protein RemA) of the ''epsA-epsB-epsC-epsD-epsE-epsF-epsG-epsH-epsI-epsJ-epsK-epsL-epsM-epsN-epsO'' operon PubMed

Protein family

• Xre family

Domains

• DNA-binding N-terminal domain (aa 1-69) PubMed
• SinI-binding C-terminal domain (aa 74-111) PubMed
• HTH cro/C1-type domain (aa 6-61) (according to UniProt)
• Sin domain (aa 65-103) (according to UniProt)

Structure

• 2YAL (PDB) (C-terminal domain, aa 74-111) PubMed
• 3QQ6 (PDB) (N-terminal domain, aa 1-69) PubMed
• 1B0N (PDB) (complex SinR-SinI) PubMed
• P06533 (AlphaFold)

Effectors of protein activity

• SinI and SlrA are antagonists to SinR  PubMed
• SlrR is an antagonist of SinR, but also acts as cofactor for SinR resulting in binding to sites within the fliE and fliI open reading frames and to premature stopp of transcription elongation PubMed

Paralogous protein(s)

• SlrR

Expression and Regulation

Operons

• Genes: sinI-sinR

  Description: PubMed

  Regulation

  • repressed during exponential growth (ScoC) PubMed

  Regulatory mechanism

  • Spo0A: activation, in a portion of cells PubMed, in spo0A regulon
  • SinR: repression, PubMed, in sinR regulon
  • AbrB: repression, PubMed, in abrB regulon
  • ScoC: repression, PubMed, in scoC regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • the mRNA is stabilized upon depletion of RNase Y PubMed

• Genes: sinR

  Description: PubMed

  Additional information

  • the mRNA is stabilized upon depletion of RNase Y (the half-life of the mRNA increases from 3.5 to 13 min) PubMed

Biological materials

Mutant

• GP923 (sinR::spec) PubMed, available in Jörg Stülke's lab
• GP736 (sinR::tetR) PubMed, available in Jörg Stülke's lab
• 1S97 (sinR::phleo), PubMed, available at BGSC
• GP1672 (''sinR-tasA::cat'') PubMed, available in Jörg Stülke's lab
• GP1663 (''yqhG-sinI-sinR-tasA''), available in Jörg Stülke's lab
• BKE24610 (sinR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATGTCATCACCTTCCTTG,  downstream forward: _UP4_TAGTGCCTGAGCAGAGGCAC
• BKK24610 (sinR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATGTCATCACCTTCCTTG,  downstream forward: _UP4_TAGTGCCTGAGCAGAGGCAC

Expression vectors

• N-terminal Strep-tag, for SPINE, expression in B. subtilis, in pGP380: pGP1083 , available in Jörg Stülke's lab
• pGP2330: in pBQ200, for expression in B. subtilis, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

FLAG-tag construct

• GP960 (spc, based on pGP1331), available in Jörg Stülke's lab

LacZ fusion

• pGP1930 (aphA3) based on pAC7, available in Jörg Stülke's lab

References

Reviews

Bavaharan A, Skilbeck CElectrical signalling in prokaryotes and its convergence with quorum sensing in Bacillus.BioEssays : news and reviews in molecular, cellular and developmental biology. 2022 Feb 23; :e2100193. PMID: 35195292
Ryan-Payseur BK, Freitag NE Biofilms: a Matter of Individual Choice. mBio. 2018 Nov 27; 9(6). pii:e02339-18. doi:10.1128/mBio.02339-18. PMID:30482826
Kalamara M, Špacapan M, Mandic-Mulec I, Stanley-Wall NR Social behaviours by Bacillus subtilis: quorum sensing, kin discrimination and beyond. Molecular microbiology. 2018 Sep 14; . doi:10.1111/mmi.14127. PMID:30218468
Cairns LS, Hobley L, Stanley-Wall NR Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms. Molecular microbiology. 2014 Aug; 93(4):587-98. doi:10.1111/mmi.12697. PMID:24988880
Vlamakis H, Chai Y, Beauregard P, Losick R, Kolter R Sticking together: building a biofilm the Bacillus subtilis way. Nature reviews. Microbiology. 2013 Mar; 11(3):157-68. doi:10.1038/nrmicro2960. PMID:23353768
Piggot P Epigenetic switching: bacteria hedge bets about staying or moving. Current biology : CB. 2010 Jun 08; 20(11):R480-2. doi:10.1016/j.cub.2010.04.020. PMID:20541494
Dubnau D Swim or chill: lifestyles of a bacillus. Genes & development. 2010 Apr 15; 24(8):735-7. doi:10.1101/gad.1923110. PMID:20395361

Original Publications

Gründling A, Brogan AP, James MJ, Ramirez-Guadiana FH, Roney IJ, Bernhardt TG, Rudner DZPgpP is a broadly conserved phosphatase required for phosphatidylglycerol lipid synthesis.Proceedings of the National Academy of Sciences of the United States of America. 2025 Feb 4; 122(5):e2418775122. PMID: 39869797
Zhang J, Yang P, Zeng Q, Zhang Y, Zhao Y, Wang L, Li Y, Wang Z, Wang QArginine kinase McsB and ClpC complex impairs the transition to biofilm formation in Bacillus subtilis.Microbiological research. 2024 Nov 29; 292:127979. PMID: 39674004
. . PMID: 39012109
Richter A, Blei F, Hu G, Schwitalla JW, Lozano-Andrade CN, Xie J, Jarmusch SA, Wibowo M, Kjeldgaard B, Surabhi S, Xu X, Jautzus T, Phippen CBW, Tyc O, Arentshorst M, Wang Y, Garbeva P, Larsen TO, Ram AFJ, van den Hondel CAM, Maróti G, Kovács ÁTEnhanced surface colonisation and competition during bacterial adaptation to a fungus.Nature communications. 2024 May 27; 15(1):4486. PMID: 38802389
Pomerleau M, Charron-Lamoureux V, Léonard L, Grenier F, Rodrigue S, Beauregard PBAdaptive laboratory evolution reveals regulators involved in repressing biofilm development as key players in Bacillus subtilis root colonization.mSystems. 2024 Jan 11; :e0084323. PMID: 38206029
Dannenberg S, Penning J, Simm A, Klumpp SThe motility-matrix production switch in Bacillus subtilis-a modeling perspective.Journal of bacteriology. 2023 Dec 13; :e0004723. PMID: 38088582
Hu G, Wang Y, Liu X, Strube ML, Wang B, Kovács ÁTSpecies and condition shape the mutational spectrum in experimentally evolved biofilms.mSystems. 2023 Sep 28; :e0054823. PMID: 37768063
Hu G, Wang Y, Blake C, Nordgaard M, Liu X, Wang B, Kovács ÁTParallel genetic adaptation of Bacillus subtilis to different plant species.Microbial genomics. 2023 Jul; 9(7). PMID: 37466402
Chen Z, Zarazúa-Osorio B, Srivastava P, Fujita M, Igoshin OAThe Slowdown of Growth Rate Controls the Single-Cell Distribution of Biofilm Matrix Production via an SinI-SinR-SlrR Network.mSystems. 2023 Feb 14; :e0062222. PMID: 36786593
Kantiwal U, Pandey JEfficient Inhibition of Bacterial Biofilm Through Interference of Protein-Protein Interaction of Master Regulator Proteins: a Proof of Concept Study with SinR- SinI Complex of Bacillus subtilis.Applied biochemistry and biotechnology. 2022 Nov 19; . PMID: 36401726
Nordgaard M, Blake C, Maróti G, Hu G, Wang Y, Strube ML, Kovács ÁTExperimental evolution of Bacillus subtilis on Arabidopsis thaliana roots reveals fast adaptation and improved root colonization.iScience. 2022 Jun 17; 25(6):104406. PMID: 35663012
Wu J, Li W, Zhao SG, Qian SH, Wang Z, Zhou MJ, Hu WS, Wang J, Hu LX, Liu Y, Xue ZLSite-directed mutagenesis of the quorum-sensing transcriptional regulator SinR affects the biosynthesis of menaquinone in Bacillus subtilis.Microbial cell factories. 2021 Jun 7; 20(1):113. PMID: 34098969
Lord ND, Norman TM, Yuan R, Bakshi S, Losick R, Paulsson J Stochastic antagonism between two proteins governs a bacterial cell fate switch. Science (New York, N.Y.). 2019 Oct 04; 366(6461):116-120. doi:10.1126/science.aaw4506. PMID:31604312
Milton ME, Draughn GL, Bobay BG, Stowe SD, Olson AL, Feldmann EA, Thompson RJ, Myers KH, Santoro MT, Kearns DB, Cavanagh J The Solution Structures and Interaction of SinR and SinI: Elucidating the Mechanism of Action of the Master Regulator Switch for Biofilm Formation in Bacillus subtilis. Journal of molecular biology. 2019 Sep 04; . pii:S0022-2836(19)30543-1. doi:10.1016/j.jmb.2019.08.019. PMID:31493408
Bartolini M, Cogliati S, Vileta D, Bauman C, Rateni L, Leñini C, Argañaraz F, Francisco M, Villalba JM, Steil L, Völker U, Grau R Regulation of biofilm aging and dispersal in by the alternative sigma factor SigB. Journal of bacteriology. 2018 Nov 05; . pii:JB.00473-18. doi:10.1128/JB.00473-18. PMID:30396900
Richter A, Hölscher T, Pausch P, Sehrt T, Brockhaus F, Bange G, Kovács ÁT Hampered motility promotes the evolution of wrinkly phenotype in Bacillus subtilis. BMC evolutionary biology. 2018 Oct 16; 18(1):155. doi:10.1186/s12862-018-1266-2. PMID:30326845
Kampf J, Gerwig J, Kruse K, Cleverley R, Dormeyer M, Grünberger A, Kohlheyer D, Commichau FM, Lewis RJ, Stülke J Selective Pressure for Biofilm Formation in Bacillus subtilis: Differential Effect of Mutations in the Master Regulator SinR on Bistability. mBio. 2018 Sep 04; 9(5). pii:e01464-18. doi:10.1128/mBio.01464-18. PMID:30181249
Fujita Y, Ogura M, Nii S, Hirooka K Dual Regulation of Bacillus subtilis kinB Gene Encoding a Sporulation Trigger by SinR through Transcription Repression and Positive Stringent Transcription Control. Frontiers in microbiology. 2017; 8:2502. doi:10.3389/fmicb.2017.02502. PMID:29321771
Hobley L, Li B, Wood JL, Kim SH, Naidoo J, Ferreira AS, Khomutov M, Khomutov A, Stanley-Wall NR, Michael AJ Spermidine promotes Bacillus subtilis biofilm formation by activating expression of the matrix regulator slrR. The Journal of biological chemistry. 2017 Jul 21; 292(29):12041-12053. doi:10.1074/jbc.M117.789644. PMID:28546427
Ogura M Post-transcriptionally generated cell heterogeneity regulates biofilm formation in Bacillus subtilis. Genes to cells : devoted to molecular & cellular mechanisms. 2016 Apr; 21(4):335-49. doi:10.1111/gtc.12343. PMID:26819068
DeLoughery A, Dengler V, Chai Y, Losick R Biofilm formation by Bacillus subtilis requires an endoribonuclease-containing multisubunit complex that controls mRNA levels for the matrix gene repressor SinR. Molecular microbiology. 2016 Jan; 99(2):425-37. doi:10.1111/mmi.13240. PMID:26434553
Gao T, Greenwich J, Li Y, Wang Q, Chai Y The Bacterial Tyrosine Kinase Activator TkmA Contributes to Biofilm Formation Largely Independently of the Cognate Kinase PtkA in Bacillus subtilis. Journal of bacteriology. 2015 Nov; 197(21):3421-32. doi:10.1128/JB.00438-15. PMID:26283769
Leiman SA, Arboleda LC, Spina JS, McLoon AL SinR is a mutational target for fine-tuning biofilm formation in laboratory-evolved strains of Bacillus subtilis. BMC microbiology. 2014 Nov 30; 14:301. doi:10.1186/s12866-014-0301-8. PMID:25433524
Subramaniam AR, Deloughery A, Bradshaw N, Chen Y, O'Shea E, Losick R, Chai Y A serine sensor for multicellularity in a bacterium. eLife. 2013 Dec 17; 2:e01501. doi:10.7554/eLife.01501. PMID:24347549
Ogura M, Yoshikawa H, Chibazakura T Regulation of the response regulator gene degU through the binding of SinR/SlrR and exclusion of SinR/SlrR by DegU in Bacillus subtilis. Journal of bacteriology. 2014 Feb; 196(4):873-81. doi:10.1128/JB.01321-13. PMID:24317403
Norman TM, Lord ND, Paulsson J, Losick R Memory and modularity in cell-fate decision making. Nature. 2013 Nov 28; 503(7477):481-6. doi:10.1038/nature12804. PMID:24256735
Gupta M, Dixit M, Rao KK Spo0A positively regulates epr expression by negating the repressive effect of co-repressors, SinR and ScoC, in Bacillus subtilis. Journal of biosciences. 2013 Jun; 38(2):291-9. . PMID:23660663
Winkelman JT, Bree AC, Bate AR, Eichenberger P, Gourse RL, Kearns DB RemA is a DNA-binding protein that activates biofilm matrix gene expression in Bacillus subtilis. Molecular microbiology. 2013 Jun; 88(5):984-97. doi:10.1111/mmi.12235. PMID:23646920
Stowe SD, Olson AL, Losick R, Cavanagh J Chemical shift assignments and secondary structure prediction of the master biofilm regulator, SinR, from Bacillus subtilis. Biomolecular NMR assignments. 2014 Apr; 8(1):155-8. doi:10.1007/s12104-013-9473-7. PMID:23475644
Newman JA, Rodrigues C, Lewis RJ Molecular basis of the activity of SinR protein, the master regulator of biofilm formation in Bacillus subtilis. The Journal of biological chemistry. 2013 Apr 12; 288(15):10766-78. doi:10.1074/jbc.M113.455592. PMID:23430750
Lei Y, Oshima T, Ogasawara N, Ishikawa S Functional analysis of the protein Veg, which stimulates biofilm formation in Bacillus subtilis. Journal of bacteriology. 2013 Apr; 195(8):1697-705. doi:10.1128/JB.02201-12. PMID:23378512
Chai Y, Beauregard PB, Vlamakis H, Losick R, Kolter R Galactose metabolism plays a crucial role in biofilm formation by Bacillus subtilis. mBio. 2012; 3(4):e00184-12. doi:10.1128/mBio.00184-12. pii:e00184-12. PMID:22893383
Cozy LM, Phillips AM, Calvo RA, Bate AR, Hsueh YH, Bonneau R, Eichenberger P, Kearns DB SlrA/SinR/SlrR inhibits motility gene expression upstream of a hypersensitive and hysteretic switch at the level of σ(D) in Bacillus subtilis. Molecular microbiology. 2012 Mar; 83(6):1210-28. doi:10.1111/j.1365-2958.2012.08003.x. PMID:22329926
Diethmaier C, Pietack N, Gunka K, Wrede C, Lehnik-Habrink M, Herzberg C, Hübner S, Stülke J A novel factor controlling bistability in Bacillus subtilis: the YmdB protein affects flagellin expression and biofilm formation. Journal of bacteriology. 2011 Nov; 193(21):5997-6007. doi:10.1128/JB.05360-11. PMID:21856853
Lehnik-Habrink M, Schaffer M, Mäder U, Diethmaier C, Herzberg C, Stülke J RNA processing in Bacillus subtilis: identification of targets of the essential RNase Y. Molecular microbiology. 2011 Sep; 81(6):1459-73. doi:10.1111/j.1365-2958.2011.07777.x. PMID:21815947
Colledge VL, Fogg MJ, Levdikov VM, Leech A, Dodson EJ, Wilkinson AJ Structure and organisation of SinR, the master regulator of biofilm formation in Bacillus subtilis. Journal of molecular biology. 2011 Aug 19; 411(3):597-613. doi:10.1016/j.jmb.2011.06.004. PMID:21708175
Chai Y, Norman T, Kolter R, Losick R Evidence that metabolism and chromosome copy number control mutually exclusive cell fates in Bacillus subtilis. The EMBO journal. 2011 Apr 06; 30(7):1402-13. doi:10.1038/emboj.2011.36. PMID:21326214
Chai Y, Kolter R, Losick R Reversal of an epigenetic switch governing cell chaining in Bacillus subtilis by protein instability. Molecular microbiology. 2010 Oct; 78(1):218-29. doi:10.1111/j.1365-2958.2010.07335.x. PMID:20923420
Chai Y, Norman T, Kolter R, Losick R An epigenetic switch governing daughter cell separation in Bacillus subtilis. Genes & development. 2010 Apr 15; 24(8):754-65. doi:10.1101/gad.1915010. PMID:20351052
Kodgire P, Rao KK A dual mode of regulation of flgM by ScoC in Bacillus subtilis. Canadian journal of microbiology. 2009 Aug; 55(8):983-9. doi:10.1139/w09-049. PMID:19898538
Chai Y, Kolter R, Losick R Paralogous antirepressors acting on the master regulator for biofilm formation in Bacillus subtilis. Molecular microbiology. 2009 Nov; 74(4):876-87. doi:10.1111/j.1365-2958.2009.06900.x. PMID:19788541
Chai Y, Kolter R, Losick R A widely conserved gene cluster required for lactate utilization in Bacillus subtilis and its involvement in biofilm formation. Journal of bacteriology. 2009 Apr; 191(8):2423-30. doi:10.1128/JB.01464-08. PMID:19201793
Chu F, Kearns DB, McLoon A, Chai Y, Kolter R, Losick R A novel regulatory protein governing biofilm formation in Bacillus subtilis. Molecular microbiology. 2008 Jun; 68(5):1117-27. doi:10.1111/j.1365-2958.2008.06201.x. PMID:18430133
Chai Y, Chu F, Kolter R, Losick R Bistability and biofilm formation in Bacillus subtilis. Molecular microbiology. 2008 Jan; 67(2):254-63. . PMID:18047568
Kodgire P, Dixit M, Rao KK ScoC and SinR negatively regulate epr by corepression in Bacillus subtilis. Journal of bacteriology. 2006 Sep; 188(17):6425-8. . PMID:16923912
Branda SS, Chu F, Kearns DB, Losick R, Kolter R A major protein component of the Bacillus subtilis biofilm matrix. Molecular microbiology. 2006 Feb; 59(4):1229-38. . PMID:16430696
Chu F, Kearns DB, Branda SS, Kolter R, Losick R Targets of the master regulator of biofilm formation in Bacillus subtilis. Molecular microbiology. 2006 Feb; 59(4):1216-28. . PMID:16430695
Kearns DB, Chu F, Branda SS, Kolter R, Losick R A master regulator for biofilm formation by Bacillus subtilis. Molecular microbiology. 2005 Feb; 55(3):739-49. . PMID:15661000
Sánchez A, Olmos J Bacillus subtilis transcriptional regulators interaction. Biotechnology letters. 2004 Mar; 26(5):403-7. . PMID:15104138
Shafikhani SH, Mandic-Mulec I, Strauch MA, Smith I, Leighton T Postexponential regulation of sin operon expression in Bacillus subtilis. Journal of bacteriology. 2002 Jan; 184(2):564-71. . PMID:11751836
Scott DJ, Leejeerajumnean S, Brannigan JA, Lewis RJ, Wilkinson AJ, Hoggett JG Quaternary re-arrangement analysed by spectral enhancement: the interaction of a sporulation repressor with its antagonist. Journal of molecular biology. 1999 Nov 12; 293(5):997-1004. . PMID:10547280
Lewis RJ, Brannigan JA, Offen WA, Smith I, Wilkinson AJ An evolutionary link between sporulation and prophage induction in the structure of a repressor:anti-repressor complex. Journal of molecular biology. 1998 Nov 13; 283(5):907-12. . PMID:9799632
Cervin MA, Lewis RJ, Brannigan JA, Spiegelman GB The Bacillus subtilis regulator SinR inhibits spoIIG promoter transcription in vitro without displacing RNA polymerase. Nucleic acids research. 1998 Aug 15; 26(16):3806-12. . PMID:9685500
Margot P, Lazarevic V, Karamata D Effect of the SinR protein on the expression of the Bacillus subtilis 168 lytABC operon. Microbial drug resistance (Larchmont, N.Y.). 1996; 2(1):119-21. . PMID:9158733
Fredrick K, Helmann JD FlgM is a primary regulator of sigmaD activity, and its absence restores motility to a sinR mutant. Journal of bacteriology. 1996 Dec; 178(23):7010-3. . PMID:8955328
Rashid MH, Sekiguchi J flaD (sinR) mutations affect SigD-dependent functions at multiple points in Bacillus subtilis. Journal of bacteriology. 1996 Nov; 178(22):6640-3. . PMID:8932324
Hahn J, Luttinger A, Dubnau D Regulatory inputs for the synthesis of ComK, the competence transcription factor of Bacillus subtilis. Molecular microbiology. 1996 Aug; 21(4):763-75. . PMID:8878039
Bai U, Mandic-Mulec I, Smith I SinI modulates the activity of SinR, a developmental switch protein of Bacillus subtilis, by protein-protein interaction. Genes & development. 1993 Jan; 7(1):139-48. . PMID:8422983
Strauch MA In vitro binding affinity of the Bacillus subtilis AbrB protein to six different DNA target regions. Journal of bacteriology. 1995 Aug; 177(15):4532-6. . PMID:7635837
Gaur NK, Cabane K, Smith I Structure and expression of the Bacillus subtilis sin operon. Journal of bacteriology. 1988 Mar; 170(3):1046-53. . PMID:3125149
Kallio PT, Fagelson JE, Hoch JA, Strauch MA The transition state regulator Hpr of Bacillus subtilis is a DNA-binding protein. The Journal of biological chemistry. 1991 Jul 15; 266(20):13411-7. . PMID:1906467