putC

168

1-pyrroline-5-carboxylate dehydrogenase

Locus: BSU_03210

Molecular weight: 56.32 kDa

Isoelectric point: 5.37

Protein length: 515 aa

Gene length: 1548 bp

Function: proline utilization

Product: 1-pyrroline-5-carboxylate dehydrogenase

Essential: no

E.C.: 1.5.1.12

Synonyms: putC, ycgN

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1012 (Galperin et al., 2021)

Gene

Coordinates: 345,479  347,026

Phenotypes of a mutant

• no growth with proline as single source of carbon PubMed
• the putC rocA double mutant is unable to grow with proline, arginine, citrulline, or ornithine as the single source of nitrogen PubMed

The protein

Catalyzed reaction/ biological activity

• H₂O + L-glutamate 5-semialdehyde + NAD⁺ --> 2 H⁺ + L-glutamate + NADH (according to UniProt)

Protein family

• aldehyde dehydrogenase family (according to UniProt)

Structure

• 3RJL (PDB) (1-pyrroline-5-carboxylate dehydrogenase from Bacillus licheniformis, 90% identity, 97% similarity)
• P94391 (AlphaFold)

Paralogous protein(s)

• YcbD, DhaS, RocA, IolA, YwdH, GabD, YfmT, AldX, AldY, GbsA

Expression and Regulation

Operons

• Genes: putB-putC-putP

  Description: PubMed

  Regulation

  • expressed under conditions that trigger sporulation (Spo0A) PubMed

  Regulatory mechanism

  • PutR: activation, PubMed, in putR regulon
  • Spo0A: activation, PubMed, in spo0A regulon
  • CodY: repression, displacement of PutR PubMed, in codY regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • overexpressed in a pnpA mutant PubMed
  • the putP part of the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

• GP3904 (''putB-putC::aphA3''), available in Jörg Stülke's lab
• GP3749 (putC::aphA3 trpC2) available in Jörg Stülke's lab PubMed
• GP3398 (rocA::tet putC::aphA3 trpC2) available in Jörg Stülke's lab PubMed
• MGNA-B993 (ycgN::erm), available at the NBRP B. subtilis, Japan
• BKE03210 (putC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TGTTGTCATGATAATCTCTC,  downstream forward: _UP4_TAAGCGGGACTAAATGGGCA
• BKK03210 (putC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TGTTGTCATGATAATCTCTC,  downstream forward: _UP4_TAAGCGGGACTAAATGGGCA

Expression vectors

• pGP3866: expression of Strep-putC by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab

References

Loading