rpmB

168

ribosomal protein bL28

Locus: BSU_15820

Molecular weight: 6.67 kDa

Isoelectric point: 12.24

Protein length: 62 aa

Gene length: 189 bp

Function: translation

Product: ribosomal protein L28 (bL28)

Essential: no

Synonyms: rpmB, yloT

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Protein synthesis, modification and degradation, Translation, Ribosomal proteins

List of homologs in different organisms, belongs to COG0227 (Galperin et al., 2021)

This gene is a member of the following regulons

Stringent response

Gene

Coordinates: 1,655,599  1,655,787

The protein

Protein family

bacterial ribosomal protein bL28 family (single member, according to UniProt)

Structure

3J9W (PDB) (the ribosome) PubMed
P37807 (AlphaFold)

Additional information

the protein is significantly underrepresented in 45S assembly intermediates that accumulate upon depletion of RbgA PubMed

Expression and Regulation

Operons

Genes: rpmB

Description: PubMed

Regulation

expression is reduced in motile cells as compared to non-motile cells PubMed

Regulatory mechanism

stringent response: negative regulation, PubMed, in stringent response

Biological materials

Mutant

BKE15820 (rpmB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTGTTTCCCTCCTCACT,  downstream forward: _UP4_TAACAAAATGAACGCCTGCC
BKK15820 (rpmB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTGTTTCCCTCCTCACT,  downstream forward: _UP4_TAACAAAATGAACGCCTGCC

References

Syvertsson S, Wang B, Staal J, Gao Y, Kort R, Hamoen LWDifferent resource allocation in a Bacillus subtilis population displaying bimodal motility.Journal of bacteriology. 2021 Mar 29; . PMID: 33782055
Galperin MY, Wolf YI, Garushyants SK, Vera Alvarez R, Koonin EVNon-essential ribosomal proteins in bacteria and archaea identified using COGs.Journal of bacteriology. 2021 Mar 22; . PMID: 33753464
Sohmen D, Chiba S, Shimokawa-Chiba N, Innis CA, Berninghausen O, Beckmann R, Ito K, Wilson DN Structure of the Bacillus subtilis 70S ribosome reveals the basis for species-specific stalling. Nature communications. 2015 Apr 23; 6:6941. doi:10.1038/ncomms7941. PMID:25903689
Jomaa A, Jain N, Davis JH, Williamson JR, Britton RA, Ortega J Functional domains of the 50S subunit mature late in the assembly process. Nucleic acids research. 2014 Mar; 42(5):3419-35. doi:10.1093/nar/gkt1295. PMID:24335279
Li N, Chen Y, Guo Q, Zhang Y, Yuan Y, Ma C, Deng H, Lei J, Gao N Cryo-EM structures of the late-stage assembly intermediates of the bacterial 50S ribosomal subunit. Nucleic acids research. 2013 Aug; 41(14):7073-83. doi:10.1093/nar/gkt423. PMID:23700310
de Jong IG, Veening JW, Kuipers OP Single cell analysis of gene expression patterns during carbon starvation in Bacillus subtilis reveals large phenotypic variation. Environmental microbiology. 2012 Dec; 14(12):3110-21. doi:10.1111/j.1462-2920.2012.02892.x. PMID:23033921
Akanuma G, Nanamiya H, Natori Y, Yano K, Suzuki S, Omata S, Ishizuka M, Sekine Y, Kawamura F Inactivation of ribosomal protein genes in Bacillus subtilis reveals importance of each ribosomal protein for cell proliferation and cell differentiation. Journal of bacteriology. 2012 Nov; 194(22):6282-91. doi:10.1128/JB.01544-12. PMID:23002217
Lauber MA, Running WE, Reilly JP B. subtilis ribosomal proteins: structural homology and post-translational modifications. Journal of proteome research. 2009 Sep; 8(9):4193-206. doi:10.1021/pr801114k. PMID:19653700