ywtE

168

dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate (minor activity)

Locus: BSU_35850

Molecular weight: 31.44 kDa

Isoelectric point: 4.76

Protein length: 286 aa

Gene length: 861 bp

Function: dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate (minor activity)

Product: unknown

Essential: no

E.C.: 3.1.3.-

Synonyms: ywtE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0561 (Galperin et al., 2021)

Gene

Coordinates: 3,695,363  3,696,223

The protein

Catalyzed reaction/ biological activity

• dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate PubMed
• 5-amino-6-(5-phospho-D-ribitylamino)uracil + H₂O --> 5-amino-6-(D-ribitylamino)uracil + phosphate (according to UniProt)

Protein family

• HAD superfamily (according to UniProt)  PubMed
• Cof family (according to UniProt)

Structure

• 1NRW (PDB) (PhoC, 39% identity)
• P96741 (AlphaFold)

Expression and Regulation

Operons

• Genes: ywtE

  Description: PubMed

• Genes: tagT-ywtE

  Description: PubMed

  Regulation

  • expressed at high salt concentrations (SigM) PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in sigM regulon

Biological materials

Mutant

• MGNA-A546 (ywtE::erm), available at the NBRP B. subtilis, Japan
• BKE35850 (ywtE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATGTAGGGGAACCTCCT,  downstream forward: _UP4_TAAAGAAAAGACTCCAGAGA
• BKK35850 (ywtE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATGTAGGGGAACCTCCT,  downstream forward: _UP4_TAAAGAAAAGACTCCAGAGA

References

Scharf A, La-Rostami F, Illarionov BA, Nemes V, Feldmann AM, Höft LS, Lösel H, Bacher A, Fischer MSystematic analysis of the effect of genomic knock-out of non-essential promiscuous HAD-like phosphatases YcsE, YitU and YwtE on flavin and adenylate content in Bacillus subtilis.Chembiochem : a European journal of chemical biology. 2024 Apr 14; :e202400165. PMID: 38616163
Sarge S, Haase I, Illarionov B, Laudert D, Hohmann HP, Bacher A, Fischer M Catalysis of an Essential Step in Vitamin B2 Biosynthesis by a Consortium of Broad Spectrum Hydrolases. Chembiochem : a European journal of chemical biology. 2015 Nov; 16(17):2466-9. doi:10.1002/cbic.201500352. PMID:26316208