acuC

168

protein deacetylase for the control of AcsA activity

Locus: BSU_29710

Molecular weight: 42.83 kDa

Isoelectric point: 5.06

Protein length: 387 aa

Gene length: 1164 bp

Function: control of AcsA activity

Product: AcsA deacetylase

Essential: no

Synonyms: acuC

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Carbon metabolism, Utilization of specific carbon sources, Utilization of organic acids

Metabolism, Lipid metabolism, Utilization of lipids, Utilization of fatty acids

Information processing, Protein synthesis, modification and degradation, Protein modification, Protein acetylases/ deacetylases

List of homologs in different organisms, belongs to COG0123 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CcpA regulon

Gene

Coordinates: 3,041,392  3,042,555

The protein

Catalyzed reaction/ biological activity

deacetylates (and thereby activates) AcsA (together with SrtN)  PubMed

Protein family

histone deacetylase family (single member, according to UniProt)

Structure

1C3R (PDB) (from Aquifex aeolicus, 35% identity) PubMed
P39067 (AlphaFold)

Expression and Regulation

Operons

Genes: acuA-acuB-acuC

Description: PubMed

Regulation

repressed by glucose (3.4-fold) (CcpA) PubMed

Regulatory mechanism

CcpA: repression, PubMed, in ccpA regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Additional information

the mRNA is quite stable (half-life 5 min) PubMed

Biological materials

Mutant

GP1209 (''acuC::kan''), available in Jörg Stülke's lab
GP1213 (''srtN::cat)(acuC::kan''), available in Jörg Stülke's lab
1A887 ( acuC::spc), PubMed, available at BGSC
BKE29710 (acuC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCTCATAGCAGATCCCTTTG,  downstream forward: _UP4_CAAAGAACAAAGTAAAAAAC
BKK29710 (acuC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCTCATAGCAGATCCCTTTG,  downstream forward: _UP4_CAAAGAACAAAGTAAAAAAC

References

Loading