spoVS

168

required for dehydratation of the spore core and assembly of the coat, mutation increases SigD-dependent gene expression, might act via SinR

Locus: BSU_16980

Molecular weight: 8.66 kDa

Isoelectric point: 6.47

Protein length: 86 aa

Gene length: 261 bp

Function: spore coat assembly, spore core dehydratation

Product: unknown

Essential: no

Synonyms: spoVS

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Lifestyles, Sporulation, Sporulation/ other

List of homologs in different organisms, belongs to COG2359 (Galperin et al., 2021)

This gene is a member of the following regulons

SigH regulon

Gene

Coordinates: 1,769,935  1,770,195

Phenotypes of a mutant

increased SigD-dependent gene expression, this might occur via SinR PubMed

The protein

Structure

2EK0 (PDB) (from Thermus thermophilus, 56% identity)
P45693 (AlphaFold)

Expression and Regulation

Operons

Genes: spoVS

Description: PubMed

Regulation

expressed at the onset of stationary phase (SigH) PubMed

Sigma factors

SigH: sigma factor, PubMed, in sigH regulon

Biological materials

Mutant

GP1601 (spoVS::cat), available in Jörg Stülke's lab
GP1848 (ymdB-spoVS::spc cassette), available in Jörg Stülke's lab
BKE16980 (spoVS::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCTGCTCCCCCTTAGT,  downstream forward: _UP4_TAAAAACAAATAAAGCATTC
BKK16980 (spoVS::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCTGCTCCCCCTTAGT,  downstream forward: _UP4_TAAAAACAAATAAAGCATTC

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

References

Galperin MY, Yutin N, Wolf YI, Vera Alvarez R, Koonin EVConservation and Evolution of the Sporulation Gene Set in Diverse Members of the Firmicutes.Journal of bacteriology. 2022 May 31; :e0007922. PMID: 35638784
Irnov I, Sharma CM, Vogel J, Winkler WC Identification of regulatory RNAs in Bacillus subtilis. Nucleic acids research. 2010 Oct; 38(19):6637-51. doi:10.1093/nar/gkq454. PMID:20525796
Rigden DJ, Galperin MY Sequence analysis of GerM and SpoVS, uncharacterized bacterial 'sporulation' proteins with widespread phylogenetic distribution. Bioinformatics (Oxford, England). 2008 Aug 15; 24(16):1793-7. doi:10.1093/bioinformatics/btn314. PMID:18562273
Perez AR, Abanes-De Mello A, Pogliano K Suppression of engulfment defects in bacillus subtilis by elevated expression of the motility regulon. Journal of bacteriology. 2006 Feb; 188(3):1159-64. . PMID:16428420
Resnekov O, Driks A, Losick R Identification and characterization of sporulation gene spoVS from Bacillus subtilis. Journal of bacteriology. 1995 Oct; 177(19):5628-35. . PMID:7559352