cheC

168

control of chemotaxis by interacting with CheD, CheY-P phosphatase, inhibition of CheR-mediated methylation of MCPs

Locus: BSU_16450

Molecular weight: 22.90 kDa

Isoelectric point: 4.03

Protein length: 209 aa

Gene length: 630 bp

Function: motility and chemotaxis

Product: CheY-P phosphatase

Essential: no

Synonyms: cheC, ylxJ

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1776 (Galperin et al., 2021)

Gene

Coordinates: 1,715,344 → 1,715,973

Phenotypes of a mutant

• defective in Swarming motility PubMed

The protein

Catalyzed reaction/ biological activity

• CheY-P phosphatase
• controls binding of CheD to chemoreceptors in response to the levels of CheY-P PubMed

Protein family

• CheC family (single member, according to UniProt)

Structure

• 2F9Z (PDB) (from Thermotoga maritima, 31% identity) PubMed
• P40403 (AlphaFold)

Effectors of protein activity

• interaction with CheD enhances phosphatase activity towards CheY-P PubMed

Paralogous protein(s)

• FliY

Expression and Regulation

Operons

• Genes: ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • see fla-che operon

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SwrA: activation, in swrA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

• Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • SwrA: activation, in swrA regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SinR: transcription elongation, binding of the SinR-SlrR heteromer to sites within fliE and fliI results in inhibition of transcription elongation PubMed, in sinR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

Biological materials

Mutant

• 1A862 (no resistance), PubMed, available at BGSC
• DS6867 (marker-less in NCIB3610) PubMed
• BKE16450 (ΔcheC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ACTCATGTCATAACCCCTTT,  downstream forward: _UP4_TTTGTCGCCTTAGGTGCATC
• BKK16450 (ΔcheC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ACTCATGTCATAACCCCTTT,  downstream forward: _UP4_TTTGTCGCCTTAGGTGCATC

References

Reviews

Loading

Original Publications

Loading