epsF

168

similar to glycosyltransferase

Locus: BSU_34320

Molecular weight: 42.46 kDa

Isoelectric point: 6.93

Protein length: 384 aa

Gene length: 1155 bp

Function: biofilm formation

Product: unknown

Essential: no

Synonyms: epsF, yveP

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation, Matrix polysaccharide synthesis

List of homologs in different organisms, belongs to COG0438 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, AbrB regulon, SinR regulon, RemA regulon, EAR riboswitch

Gene

Coordinates: 3,523,270 → 3,524,424

The EAR RNA switch

Loading

The protein

Protein family

glycosyltransferase 1 family (according to UniProt)
Glycosyltransferase 4 subfamily (according to UniProt)

Structure

P71055 (AlphaFold)

Expression and Regulation

Operons

Genes: epsA-epsB-epsC-epsD-epsE-epsF-epsG-epsH-epsI-epsJ-epsK-epsL-epsM-epsN-epsO

Description: PubMed

Regulation

repressed by SinR PubMed

Regulatory mechanism

RemA: activation, PubMed, in remA regulon
AbrB: repression, PubMed, in abrB regulon
SinR: anti-activation, (prevents binding of RemA) PubMed, in sinR regulon
EAR riboswitch: processive antitermination, in EAR riboswitch

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Additional information

induction by sequestration of SinR by SinI or SlrA PubMed

Biological materials

Mutant

MGNA-A069 (yveP::erm), available at the NBRP B. subtilis, Japan
BKE34320 (ΔepsF::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AACATGGAGCACGCGCTTTT,  downstream forward: _UP4_AGCACGGAAAAGGACCATAA
BKK34320 (ΔepsF::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AACATGGAGCACGCGCTTTT,  downstream forward: _UP4_AGCACGGAAAAGGACCATAA

Labs working on this gene/protein

Richard Losick, Harvard Univ., Cambridge, USA homepage

References

Reviews

Loading