ssuB

168

aliphatic sulfonate ABC transporter (ATP-binding protein)

Locus: BSU_08830

Molecular weight: 30.08 kDa

Isoelectric point: 8.67

Protein length: 255 aa

Gene length: 768 bp

Function: sulfonate uptake

Product: aliphatic sulfonate ABC transporter (ATP-binding protein)

Essential: no

Synonyms: ssuB, ygaL

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, ABC transporters, Importers, Uptake of ions

Metabolism, Additional metabolic pathways, Sulfur metabolism

Metabolism, Additional metabolic pathways, Sulfur metabolism, sulfur metabolism/ general

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG1116 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CymR regulon

Gene

Coordinates: 961,394  962,161

The protein

Protein family

ABC transporter superfamily (according to UniProt)

Domains

ABC transporter domain (aa 7-231) (according to UniProt)

Structure

1Q1B (PDB) (MalK from E. coli, 38% identity) PubMed
P97027 (AlphaFold)

Paralogous protein(s)

YtlC

Localization

associated to the membrane (via SsuC) PubMed

Expression and Regulation

Operons

Genes: ssuB-ssuA-ssuC-ssuD-ygaN

Description: PubMed

Regulation

repressed in the presence of cysteine (CymR) PubMed

Regulatory mechanism

CymR: repression, PubMed, in cymR regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

MGNA-A249 (ygaL::erm), available at the NBRP B. subtilis, Japan
BKE08830 (ssuB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTTTTATCCCTCTCTTTC,  downstream forward: _UP4_ATATAGAAAGGGCGGAAGCG
BKK08830 (ssuB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTTTTATCCCTCTCTTTC,  downstream forward: _UP4_ATATAGAAAGGGCGGAAGCG

References

Mahendran A, Orlando BJGenome wide structural prediction of ABC transporter systems in Bacillus subtilis.Frontiers in microbiology. 2024; 15:1469915. PMID: 39397791
Even S, Burguière P, Auger S, Soutourina O, Danchin A, Martin-Verstraete I Global control of cysteine metabolism by CymR in Bacillus subtilis. Journal of bacteriology. 2006 Mar; 188(6):2184-97. . PMID:16513748
Erwin KN, Nakano S, Zuber P Sulfate-dependent repression of genes that function in organosulfur metabolism in Bacillus subtilis requires Spx. Journal of bacteriology. 2005 Jun; 187(12):4042-9. . PMID:15937167
Chen J, Lu G, Lin J, Davidson AL, Quiocho FA A tweezers-like motion of the ATP-binding cassette dimer in an ABC transport cycle. Molecular cell. 2003 Sep; 12(3):651-61. . PMID:14527411
van der Ploeg JR, Barone M, Leisinger T Expression of the Bacillus subtilis sulphonate-sulphur utilization genes is regulated at the levels of transcription initiation and termination. Molecular microbiology. 2001 Mar; 39(5):1356-65. . PMID:11251850
Quentin Y, Fichant G, Denizot F Inventory, assembly and analysis of Bacillus subtilis ABC transport systems. Journal of molecular biology. 1999 Apr 02; 287(3):467-84. . PMID:10092453
van der Ploeg JR, Cummings NJ, Leisinger T, Connerton IF Bacillus subtilis genes for the utilization of sulfur from aliphatic sulfonates. Microbiology (Reading, England). 1998 Sep; 144 ( Pt 9):2555-61. . PMID:9782504