yndF

yndF
168

part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF] germinant receptor of unknown specificity

locus
BSU_17770
Molecular weight
44.66 kDa
pI
7.26
Protein length
Gene length
function
[category|SW.4.2.4|Germination]
product
part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF] germinant receptor
essential
no
synonyms
yndF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5903 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,910,167  1,911,381
Phenotypes of a mutant
increased resistance to predation by Dictyostelium discoideum [pubmed|40991432]
The protein
Protein family
[wiki|GerABKC lipoprotein family] (according to UniProt)
Structure
[PDB|3N54] ([protein|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC], 29% identity) [pubmed|20654628]
[AF|O31810]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]
description
[Pubmed|16497325]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]→[gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]

2025-10-16 14:31:51

ghost

149

2475fc3f605374c7d03f837ccdb4b7cf919dd1e9

8FEE9610941E29EE00A37E1F39BFC210F89F0F5C

Biological materials
Mutant
MGNA-A024 (yndF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/24 NBRP B. subtilis, Japan]
BKE17770 ([gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCAGGCAATTGACGTT,  downstream forward: _UP4_TAATGAATCCCAAGGAAGAG
BKK17770 ([gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCAGGCAATTGACGTT,  downstream forward: _UP4_TAATGAATCCCAAGGAAGAG
References
15699190,16497325,10762253,20654628,40991432

2211659780DEC3F4131B127E68EEF626534DF4BE

Page visits: 4735

Time of last update: 2025-10-26 01:49:49

Author of last update: Jstuelk