mbl

168

cell shape-determining protein, forms filaments, the polymers control/restrict the mobility of the cell wall elongation enzyme complex, required for CwlO activity, required for WTA and LTA synthesis/attachment with an impact on growth and cell-shape determination (function not shared with MreB)

Locus: BSU_36410

Molecular weight: 35.70 kDa

Isoelectric point: 5.67

Protein length: 333 aa

Gene length: 1002 bp

Function: cell shape determination

Product: MreB-like protein

Essential: yes

Synonyms: mbl

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1077 (Galperin et al., 2021)

Gene

Coordinates: 3,747,254  3,748,255

Phenotypes of a mutant

• essential PubMed
• non-viable in the absence of low Mg²⁺, growth can be rescued by the addition of mirubactin C PubMed
• readily accumulate rsgI suppressor mutants PubMed
• the growth defect of the mutant can be suppressed by over expression of MprF PubMed
• the growth defect can be rescued by iron-chelating compounds or by reducing the iron content in the medium PubMed
• the growth defect can be rescued by overexpression of murG PubMed
• the growth defect can be suppressed by inactivation of any of the following genes: glmR, ptsI, ltaS, yfnI, bcrC, tseB, yerH, tagV, gtcA, yabM, amj, or uppS PubMed

The protein

Catalyzed reaction/ biological activity

• forms helical filaments in a heterologous system PubMed
• required for CwlO activity PubMed

Protein family

• FtsA/MreB family (according to UniProt)

Structure

• 1JCF (PDB) (MreB from Thermotoga maritima, 52% identity) PubMed
• P39751 (AlphaFold)

Paralogous protein(s)

• MreB, MreBH

Localization

• during logarithmic growth, Mbl forms discrete patches that move processively along peripheral tracks perpendicular to the cell axis PubMed
• forms transverse bands as cells enter the stationary phase PubMed
• close to the inner surface of the cytoplasmic membrane PubMed
• reports on helical structures formed by Mbl PubMed seem to be misinterpretation of data PubMed
• Mbl patch speed depends on the growth rate, the faster growth, the higher the patch speed PubMed

Expression and Regulation

Operons

• Genes: mbl

  Description: PubMed

  Regulation

  • expressed early during sporulation in the mother cell (SigE) PubMed

  Regulatory mechanism

  • stringent response: negative regulation, in stringent response

  Sigma factors

  • SigE: sigma factor, promoter p1, upstream of Usd PubMed, in sigE regulon
  • SigA: sigma factor, promoter p2, upstream of Mbl PubMed, in sigA regulon

  Additional information

  • An antisense RNA is predicted for 'mbl' PubMed

• Genes: usd-spoIIID-mbl

  Description: PubMed

  Regulation

  • expressed early during sporulation in the mother cell (SigE) PubMed.

  Sigma factors

  • SigE: sigma factor, PubMed, in sigE regulon

  Additional information

  • An antisense RNA is predicted for 'mbl' PubMed

Additional information

• the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

• BKE36410 (mbl::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTATTTATATCCTCCTT,  downstream forward: _UP4_TGATTTCACAAACCTCATTC

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

• available in the Jeff Errington's and Peter Graumann's labs

Labs working on this gene/protein

• Peter Graumann, Freiburg University, Germany homepage

References

Original Publications

Loading

Localization

Loading