clpC

168

AAA unfoldase, ATPase subunit of the ClpC-ClpP protease, directs proteins phosphorylated on arginine residues to ClpP

Locus: BSU_00860

Molecular weight: 89.93 kDa

Isoelectric point: 5.75

Protein length: 810 aa

Gene length: 2433 bp

Function: protein degradation, positive regulator of autolysin (LytC and LytD) synthesis

Product: AAA unfoldase, ATPase subunit of the ClpC-ClpP protease

Essential: no

Synonyms: clpC, mecB

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell wall/ other

Information processing, Protein synthesis, modification and degradation, Proteolysis, Additional proteins involved in proteolysis

Lifestyles, Exponential and early post-exponential lifestyles, Swarming

Lifestyles, Sporulation, Sporulation proteins, Sporulation proteins/ other

Lifestyles, Coping with stress, General stress proteins (controlled by SigB)

Lifestyles, Coping with stress, Heat shock proteins

Groups of genes, Phosphoproteins, Phosphorylation on an Arg residue

List of homologs in different organisms, belongs to COG0542 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, SigM regulon, CtsR regulon, SigB regulon, SigF regulon, Spx regulon

Gene

Coordinates: 103,572  106,004

Phenotypes of a mutant

inactivation of clpC reduces sporulation efficiency to 0.4% that of wild type cells; delayed entry into sporulation, defect in engulfment with reduced SigG activity, and production of small spores PubMed
defective in Swarming motility PubMed

The protein

Catalyzed reaction/ biological activity

ATPase/chaperone

Protein family

ClpA/ClpB family (with ClpE, according to UniProt)

Domains

AAA-ATPase PFAM
UVR domain (aa 417-452) (according to UniProt)

Structure

7ABR (PDB) PubMed
3J3T (PDB) (MecA₆-ClpC₆ complex) PubMed
3PXG (PDB) PubMed
8B3S (PDB) (the MdfA-ClpC complex) PubMed
P37571 (AlphaFold)

Modification

phosphorylated on Arg-5 and Arg-254 PubMed
phosphorylated on Arg-70 PubMed

Paralogous protein(s)

ClpE

Localization

cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heatshock, colocalization with ClpP PubMed
forms foci coincident with nucleoid edges, usually near cell poles PubMed

Additional information

subject to Clp-dependent proteolysis upon glucose starvation PubMed

Expression and Regulation

Operons

Genes: ctsR-mcsA-mcsB-clpC-radA-disA

Description: PubMed

Regulation

expressed during germination and spore outgrowth PubMed

Regulatory mechanism

CtsR: repression, PubMed, in ctsR regulon
Spx: activation, PubMed, in spx regulon

Sigma factors

SigM: sigma factor, PubMed, in sigM regulon
SigA: sigma factor, PubMed, in sigA regulon
SigB: sigma factor, PubMed PubMed, in sigB regulon
SigF: sigma factor, PubMed, in sigF regulon

Biological materials

Mutant

GP3782 (ΔclpC::neo) available in Jörg Stülke's lab
GP3808 (ΔclpC::spc) available in Jörg Stülke's lab
clpC::tet available from the Hamoen Lab
BP98 (clpC::spc), available in Fabian Commichau's lab PubMed
BKE00860 (clpC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCGTTCTGTAAATCTTCCAA,  downstream forward: _UP4_TAATATAGAAGACGGAAATG
BKK00860 (clpC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCGTTCTGTAAATCTTCCAA,  downstream forward: _UP4_TAATATAGAAGACGGAAATG

Expression vectors

pGP3684 (N-terminal 6xHis-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab
pGP3924: expression of clpC by pBQ200 in B. subtilis, available in Jörg Stülke's lab

Antibody

available in Ulf Gerth's and Jörg Stülke's labs

GFP fusion

C-terminal GFP fusions (single copy, also as CFP and YFP variants) available from the Hamoen Lab

Labs working on this gene/protein

Leendert Hamoen, Newcastle University, UK homepage
Kürsad Turgay, Freie Universitt Berlin, Germany homepage

References

Reviews

Wen ZT, Ellepola K, Wu HMecA: A Multifunctional ClpP-Dependent and Independent Regulator in Gram-Positive Bacteria.Molecular microbiology. 2025 May; 123(5):433-438. PMID: 40070161
Illigmann A, Thoma Y, Pan S, Reinhardt L, Brötz-Oesterhelt HContribution of the Clp Protease to Bacterial Survival and Mitochondrial Homoeostasis.Microbial physiology. 2021 Aug 26; :1-20. PMID: 34438398
Harwood CR, Kikuchi YThe ins and outs of Bacillus proteases: activities, functions and commercial significance.FEMS microbiology reviews. 2021 Aug 19; . PMID: 34410368
Elsholz AKW, Birk MS, Charpentier E, Turgay K Functional Diversity of AAA+ Protease Complexes in Bacillus subtilis. Frontiers in molecular biosciences. 2017; 4:44. doi:10.3389/fmolb.2017.00044. PMID:28748186
Olivares AO, Baker TA, Sauer RT Mechanistic insights into bacterial AAA+ proteases and protein-remodelling machines. Nature reviews. Microbiology. 2016 Jan; 14(1):33-44. doi:10.1038/nrmicro.2015.4. PMID:26639779
Molière N, Turgay K General and regulatory proteolysis in Bacillus subtilis. Sub-cellular biochemistry. 2013; 66:73-103. doi:10.1007/978-94-007-5940-4_4. PMID:23479438
Battesti A, Gottesman S Roles of adaptor proteins in regulation of bacterial proteolysis. Current opinion in microbiology. 2013 Apr; 16(2):140-7. doi:10.1016/j.mib.2013.01.002. pii:S1369-5274(13)00005-2. PMID:23375660
Molière N, Turgay K Chaperone-protease systems in regulation and protein quality control in Bacillus subtilis. Research in microbiology. 2009 Nov; 160(9):637-44. doi:10.1016/j.resmic.2009.08.020. PMID:19781636
Kirstein J, Molière N, Dougan DA, Turgay K Adapting the machine: adaptor proteins for Hsp100/Clp and AAA+ proteases. Nature reviews. Microbiology. 2009 Aug; 7(8):589-99. doi:10.1038/nrmicro2185. PMID:19609260
Frees D, Savijoki K, Varmanen P, Ingmer H Clp ATPases and ClpP proteolytic complexes regulate vital biological processes in low GC, Gram-positive bacteria. Molecular microbiology. 2007 Mar; 63(5):1285-95. . PMID:17302811

Original Publications

Massoni SC, Evans NJ, Hantke I, Fenton C, Torpey JH, Collins KM, Krysztofinska EM, Muench JH, Thapaliya A, Martínez-Lumbreras S, Hart Ferrell S, Slater C, Wang X, Fekade R, Obwar S, Yin S, Vazquez A, Prior CB, Turgay K, Isaacson RL, Camp AHMdfA is a novel ClpC adaptor protein that functions in the developing Bacillus subtilis spore.Genes & development. 2025 Mar 14; 39(7-8):510-23. PMID: 40086879
Riley EP, Lyda JA, Reyes-Matte O, Sugie J, Kasu IR, Enustun E, Armbruster EG, Ravishankar S, Isaacson RL, Camp AH, Lopez-Garrido J, Pogliano KDevelopmentally regulated proteolysis by MdfA and ClpCP mediates metabolic differentiation during Bacillus subtilis sporulation.Genes & development. 2025 Mar 14; 39(7-8):524-37. PMID: 40086876
Zhang J, Yang P, Zeng Q, Zhang Y, Zhao Y, Wang L, Li Y, Wang Z, Wang QArginine kinase McsB and ClpC complex impairs the transition to biofilm formation in Bacillus subtilis.Microbiological research. 2024 Nov 29; 292:127979. PMID: 39674004
Ishikawa F, Uchida C, Tanabe GProteolytic Regulation in the Biosynthesis of Natural Product Via a ClpP Protease System.ACS chemical biology. 2024 Aug 3; . PMID: 39096241
Morreale FE, Kleine S, Leodolter J, Junker S, Hoi DM, Ovchinnikov S, Okun A, Kley J, Kurzbauer R, Junk L, Guha S, Podlesainski D, Kazmaier U, Boehmelt G, Weinstabl H, Rumpel K, Schmiedel VM, Hartl M, Haselbach D, Meinhart A, Kaiser M, Clausen TBacPROTACs mediate targeted protein degradation in bacteria.Cell. 2022 Jun 23; 185(13):2338-2353.e18. PMID: 35662409
Sanchez S, Snider EV, Wang X, Kearns DBIdentification of Genes Required for Swarming Motility in Bacillus subtilis Using Transposon Mutagenesis and High-Throughput Sequencing (TnSeq).Journal of bacteriology. 2022 Jun 21; 204(6):e0008922. PMID: 35638827
Mulvenna N, Hantke I, Burchell L, Nicod S, Bell D, Turgay K, Wigneshweraraj S Xenogeneic modulation of the ClpCP protease of by a phage-encoded adaptor-like protein. The Journal of biological chemistry. 2019 Jul 30; . pii:jbc.RA119.010007. doi:10.1074/jbc.RA119.010007. PMID:31362989
Zhou B, Semanjski M, Orlovetskie N, Bhattacharya S, Alon S, Argaman L, Jarrous N, Zhang Y, Macek B, Sinai L, Ben-Yehuda S Arginine dephosphorylation propels spore germination in bacteria. Proceedings of the National Academy of Sciences of the United States of America. 2019 Jun 20; . pii:201817742. doi:10.1073/pnas.1817742116. PMID:31221751
Tanner AW, Carabetta VJ, Dubnau D ClpC and MecA, components of a proteolytic machine, prevent Spo0A-P-dependent transcription without degradation. Molecular microbiology. 2018 Apr; 108(2):178-186. doi:10.1111/mmi.13928. PMID:29446505
Carroni M, Franke KB, Maurer M, Jäger J, Hantke I, Gloge F, Linder D, Gremer S, Turgay K, Bukau B, Mogk A Regulatory coiled-coil domains promote head-to-head assemblies of AAA+ chaperones essential for tunable activity control. eLife. 2017 Nov 22; 6. doi:10.7554/eLife.30120. pii:e30120. PMID:29165246
Gerth U, Krieger E, Zühlke D, Reder A, Völker U, Hecker M Stability of proteins out of service - The GapB case of Bacillus subtilis. Journal of bacteriology. 2017 Jul 31; . pii:JB.00148-17. doi:10.1128/JB.00148-17. PMID:28760849
Liu TY, Chu SH, Hu YN, Wang JJ, Shaw GC Genetic evidence that multiple proteases are involved in modulation of heat-induced activation of the sigma factor SigI in Bacillus subtilis. FEMS microbiology letters. 2017 Apr 01; 364(7). doi:10.1093/femsle/fnx054. PMID:28333276
Trentini DB, Suskiewicz MJ, Heuck A, Kurzbauer R, Deszcz L, Mechtler K, Clausen T Arginine phosphorylation marks proteins for degradation by a Clp protease. Nature. 2016 Nov 03; 539(7627):48-53. doi:10.1038/nature20122. PMID:27749819
Molière N, Hoßmann J, Schäfer H, Turgay K Role of Hsp100/Clp Protease Complexes in Controlling the Regulation of Motility in Bacillus subtilis. Frontiers in microbiology. 2016; 7:315. doi:10.3389/fmicb.2016.00315. PMID:27014237
Meeske AJ, Rodrigues CD, Brady J, Lim HC, Bernhardt TG, Rudner DZ High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis. PLoS biology. 2016 Jan; 14(1):e1002341. doi:10.1371/journal.pbio.1002341. PMID:26735940
Fuhrmann J, Subramanian V, Thompson PR Synthesis and Use of a Phosphonate Amidine to Generate an Anti-Phosphoarginine-Specific Antibody. Angewandte Chemie (International ed. in English). 2015 Dec 01; 54(49):14715-8. doi:10.1002/anie.201506737. PMID:26458230
Stannek L, Gunka K, Care RA, Gerth U, Commichau FM Factors that mediate and prevent degradation of the inactive and unstable GudB protein in Bacillus subtilis. Frontiers in microbiology. 2014; 5:758. doi:10.3389/fmicb.2014.00758. PMID:25610436
Schmidt A, Trentini DB, Spiess S, Fuhrmann J, Ammerer G, Mechtler K, Clausen T Quantitative phosphoproteomics reveals the role of protein arginine phosphorylation in the bacterial stress response. Molecular & cellular proteomics : MCP. 2014 Feb; 13(2):537-50. doi:10.1074/mcp.M113.032292. PMID:24263382
Liu J, Mei Z, Li N, Qi Y, Xu Y, Shi Y, Wang F, Lei J, Gao N Structural dynamics of the MecA-ClpC complex: a type II AAA+ protein unfolding machine. The Journal of biological chemistry. 2013 Jun 14; 288(24):17597-608. doi:10.1074/jbc.M113.458752. PMID:23595989
Elsholz AK, Turgay K, Michalik S, Hessling B, Gronau K, Oertel D, Mäder U, Bernhardt J, Becher D, Hecker M, Gerth U Global impact of protein arginine phosphorylation on the physiology of Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 2012 May 08; 109(19):7451-6. doi:10.1073/pnas.1117483109. PMID:22517742
Brown CT, Fishwick LK, Chokshi BM, Cuff MA, Jackson JM, Oglesby T, Rioux AT, Rodriguez E, Stupp GS, Trupp AH, Woollcombe-Clarke JS, Wright TN, Zaragoza WJ, Drew JC, Triplett EW, Nicholson WL Whole-genome sequencing and phenotypic analysis of Bacillus subtilis mutants following evolution under conditions of relaxed selection for sporulation. Applied and environmental microbiology. 2011 Oct; 77(19):6867-77. doi:10.1128/AEM.05272-11. PMID:21821766
Elsholz AK, Hempel K, Michalik S, Gronau K, Becher D, Hecker M, Gerth U Activity control of the ClpC adaptor McsB in Bacillus subtilis. Journal of bacteriology. 2011 Aug; 193(15):3887-93. doi:10.1128/JB.00079-11. PMID:21622759
Wang F, Mei Z, Qi Y, Yan C, Hu Q, Wang J, Shi Y Structure and mechanism of the hexameric MecA-ClpC molecular machine. Nature. 2011 Mar 17; 471(7338):331-5. doi:10.1038/nature09780. PMID:21368759
Chai Y, Kolter R, Losick R Reversal of an epigenetic switch governing cell chaining in Bacillus subtilis by protein instability. Molecular microbiology. 2010 Oct; 78(1):218-29. doi:10.1111/j.1365-2958.2010.07335.x. PMID:20923420
Elsholz AK, Michalik S, Zühlke D, Hecker M, Gerth U CtsR, the Gram-positive master regulator of protein quality control, feels the heat. The EMBO journal. 2010 Nov 03; 29(21):3621-9. doi:10.1038/emboj.2010.228. PMID:20852588
Ogura M, Tsukahara K Autoregulation of the Bacillus subtilis response regulator gene degU is coupled with the proteolysis of DegU-P by ClpCP. Molecular microbiology. 2010 Mar; 75(5):1244-59. doi:10.1111/j.1365-2958.2010.07047.x. PMID:20070525
Mei Z, Wang F, Qi Y, Zhou Z, Hu Q, Li H, Wu J, Shi Y Molecular determinants of MecA as a degradation tag for the ClpCP protease. The Journal of biological chemistry. 2009 Dec 04; 284(49):34366-75. doi:10.1074/jbc.M109.053017. PMID:19767395
Kojetin DJ, McLaughlin PD, Thompson RJ, Dubnau D, Prepiak P, Rance M, Cavanagh J Structural and motional contributions of the Bacillus subtilis ClpC N-domain to adaptor protein interactions. Journal of molecular biology. 2009 Apr 03; 387(3):639-52. doi:10.1016/j.jmb.2009.01.046. PMID:19361434
Kojetin DJ, McLaughlin PD, Thompson RJ, Dubnau D, Prepiak P, Rance M, Cavanagh J Structural and motional contributions of the Bacillus subtilis ClpC N-domain to adaptor protein interactions. Journal of molecular biology. 2009 Apr 03; 387(3):639-52. doi:10.1016/j.jmb.2009.01.046. PMID:19361434
Hahn J, Kramer N, Briley K, Dubnau D McsA and B mediate the delocalization of competence proteins from the cell poles of Bacillus subtilis. Molecular microbiology. 2009 Apr; 72(1):202-15. doi:10.1111/j.1365-2958.2009.06636.x. PMID:19226326
Kirstein J, Strahl H, Molière N, Hamoen LW, Turgay K Localization of general and regulatory proteolysis in Bacillus subtilis cells. Molecular microbiology. 2008 Nov; 70(3):682-94. doi:10.1111/j.1365-2958.2008.06438.x. PMID:18786145
Kain J, He GG, Losick R Polar localization and compartmentalization of ClpP proteases during growth and sporulation in Bacillus subtilis. Journal of bacteriology. 2008 Oct; 190(20):6749-57. doi:10.1128/JB.00589-08. PMID:18689476
Simmons LA, Grossman AD, Walker GC Clp and Lon proteases occupy distinct subcellular positions in Bacillus subtilis. Journal of bacteriology. 2008 Oct; 190(20):6758-68. doi:10.1128/JB.00590-08. PMID:18689473
Gerth U, Kock H, Kusters I, Michalik S, Switzer RL, Hecker M Clp-dependent proteolysis down-regulates central metabolic pathways in glucose-starved Bacillus subtilis. Journal of bacteriology. 2008 Jan; 190(1):321-31. . PMID:17981983
Prepiak P, Dubnau D A peptide signal for adapter protein-mediated degradation by the AAA+ protease ClpCP. Molecular cell. 2007 Jun 08; 26(5):639-47. . PMID:17560370
Kirstein J, Dougan DA, Gerth U, Hecker M, Turgay K The tyrosine kinase McsB is a regulated adaptor protein for ClpCP. The EMBO journal. 2007 Apr 18; 26(8):2061-70. . PMID:17380125
Kirstein J, Schlothauer T, Dougan DA, Lilie H, Tischendorf G, Mogk A, Bukau B, Turgay K Adaptor protein controlled oligomerization activates the AAA+ protein ClpC. The EMBO journal. 2006 Apr 05; 25(7):1481-91. . PMID:16525504
Wang ST, Setlow B, Conlon EM, Lyon JL, Imamura D, Sato T, Setlow P, Losick R, Eichenberger P The forespore line of gene expression in Bacillus subtilis. Journal of molecular biology. 2006 Apr 21; 358(1):16-37. . PMID:16497325
Kirstein J, Zühlke D, Gerth U, Turgay K, Hecker M A tyrosine kinase and its activator control the activity of the CtsR heat shock repressor in B. subtilis. The EMBO journal. 2005 Oct 05; 24(19):3435-45. . PMID:16163393
Kock H, Gerth U, Hecker M MurAA, catalysing the first committed step in peptidoglycan biosynthesis, is a target of Clp-dependent proteolysis in Bacillus subtilis. Molecular microbiology. 2004 Feb; 51(4):1087-102. . PMID:14763982
Gerth U, Kirstein J, Mostertz J, Waldminghaus T, Miethke M, Kock H, Hecker M Fine-tuning in regulation of Clp protein content in Bacillus subtilis. Journal of bacteriology. 2004 Jan; 186(1):179-91. . PMID:14679237
Pan Q, Losick R Unique degradation signal for ClpCP in Bacillus subtilis. Journal of bacteriology. 2003 Sep; 185(17):5275-8. . PMID:12923101
Schlothauer T, Mogk A, Dougan DA, Bukau B, Turgay K MecA, an adaptor protein necessary for ClpC chaperone activity. Proceedings of the National Academy of Sciences of the United States of America. 2003 Mar 04; 100(5):2306-11. . PMID:12598648
Nakano MM, Nakano S, Zuber P Spx (YjbD), a negative effector of competence in Bacillus subtilis, enhances ClpC-MecA-ComK interaction. Molecular microbiology. 2002 Jun; 44(5):1341-9. . PMID:12028382
Persuh M, Mandic-Mulec I, Dubnau D A MecA paralog, YpbH, binds ClpC, affecting both competence and sporulation. Journal of bacteriology. 2002 Apr; 184(8):2310-3. . PMID:11914365
Turgay K, Persuh M, Hahn J, Dubnau D Roles of the two ClpC ATP binding sites in the regulation of competence and the stress response. Molecular microbiology. 2001 Nov; 42(3):717-27. . PMID:11722737
Pan Q, Garsin DA, Losick R Self-reinforcing activation of a cell-specific transcription factor by proteolysis of an anti-sigma factor in B. subtilis. Molecular cell. 2001 Oct; 8(4):873-83. . PMID:11684022
Petersohn A, Brigulla M, Haas S, Hoheisel JD, Völker U, Hecker M Global analysis of the general stress response of Bacillus subtilis. Journal of bacteriology. 2001 Oct; 183(19):5617-31. . PMID:11544224
Krüger E, Witt E, Ohlmeier S, Hanschke R, Hecker M The clp proteases of Bacillus subtilis are directly involved in degradation of misfolded proteins. Journal of bacteriology. 2000 Jun; 182(11):3259-65. . PMID:10809708
Persuh M, Turgay K, Mandic-Mulec I, Dubnau D The N- and C-terminal domains of MecA recognize different partners in the competence molecular switch. Molecular microbiology. 1999 Aug; 33(4):886-94. . PMID:10447896
Derré I, Rapoport G, Msadek T CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in gram-positive bacteria. Molecular microbiology. 1999 Jan; 31(1):117-31. . PMID:9987115
Derré I, Rapoport G, Msadek T CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in gram-positive bacteria. Molecular microbiology. 1999 Jan; 31(1):117-31. . PMID:9987115
Turgay K, Hahn J, Burghoorn J, Dubnau D Competence in Bacillus subtilis is controlled by regulated proteolysis of a transcription factor. The EMBO journal. 1998 Nov 16; 17(22):6730-8. . PMID:9890793
Krüger E, Msadek T, Ohlmeier S, Hecker M The Bacillus subtilis clpC operon encodes DNA repair and competence proteins. Microbiology (Reading, England). 1997 Apr; 143 ( Pt 4):1309-16. . PMID:9141693
Turgay K, Hamoen LW, Venema G, Dubnau D Biochemical characterization of a molecular switch involving the heat shock protein ClpC, which controls the activity of ComK, the competence transcription factor of Bacillus subtilis. Genes & development. 1997 Jan 01; 11(1):119-28. . PMID:9000055
Krüger E, Msadek T, Hecker M Alternate promoters direct stress-induced transcription of the Bacillus subtilis clpC operon. Molecular microbiology. 1996 May; 20(4):713-23. . PMID:8793870
Krüger E, Völker U, Hecker M Stress induction of clpC in Bacillus subtilis and its involvement in stress tolerance. Journal of bacteriology. 1994 Jun; 176(11):3360-7. . PMID:8195092
Kong L, Dubnau D Regulation of competence-specific gene expression by Mec-mediated protein-protein interaction in Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 1994 Jun 21; 91(13):5793-7. . PMID:8016067
Msadek T, Kunst F, Rapoport G MecB of Bacillus subtilis, a member of the ClpC ATPase family, is a pleiotropic regulator controlling competence gene expression and growth at high temperature. Proceedings of the National Academy of Sciences of the United States of America. 1994 Jun 21; 91(13):5788-92. . PMID:8016066
Roggiani M, Hahn J, Dubnau D Suppression of early competence mutations in Bacillus subtilis by mec mutations. Journal of bacteriology. 1990 Jul; 172(7):4056-63. . PMID:2113920