atpG

168

ATP synthase, part of the F1 complex (subunit gamma)

Locus: BSU_36820

Molecular weight: 31.50 kDa

Isoelectric point: 6.64

Protein length: 287 aa

Gene length: 864 bp

Function: ATP synthesis

Product: ATP synthase (subunit gamma)

Essential: no

Synonyms: atpG

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0224 (Galperin et al., 2021)

Gene

Coordinates: 3,782,938  3,783,801

The protein

Catalyzed reaction/ biological activity

• ATP synthesis see a video

Protein family

• ATPase gamma chain family (single member, according to UniProt)

Structure

• 4XD7 (PDB) (from Geobacillus kaustophilus, 69% identity) PubMed
• P37810 (AlphaFold)

Effectors of protein activity

• ATPase activity is inhibited upon binding of Mg-ADP to AtpD PubMed

Localization

• membrane, peripheral via theF0 complex

Expression and Regulation

Operons

• Genes: atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC

  Description: PubMed

  Regulation

  • Rel dependent downregulation (Class I) during stringent response PubMed
  • the mRNA is processed between atpI and atpB by RNase Y, this requires the RicA-RicF-RicT complex PubMed

  Regulatory mechanism

  • stringent response: negative regulation, in stringent response

Biological materials

Mutant

• BKE36820 (atpG::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAAGATTTCACCACCTTTT,  downstream forward: _UP4_TAGAAAGATTTTGTCAGGAG
• BKK36820 (atpG::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAAGATTTCACCACCTTTT,  downstream forward: _UP4_TAGAAAGATTTTGTCAGGAG

References

Reviews

Walker JE The ATP synthase: the understood, the uncertain and the unknown. Biochemical Society transactions. 2013 Feb 01; 41(1):1-16. doi:10.1042/BST20110773. PMID:23356252
Iino R, Noji H Operation mechanism of F(o) F(1)-adenosine triphosphate synthase revealed by its structure and dynamics. IUBMB life. 2013 Mar; 65(3):238-46. doi:10.1002/iub.1120. PMID:23341301
Sielaff H, Börsch M Twisting and subunit rotation in single F(O)(F1)-ATP synthase. Philosophical transactions of the Royal Society of London. Series B, Biological sciences. 2013 Feb 05; 368(1611):20120024. doi:10.1098/rstb.2012.0024. PMID:23267178
Senior AE Two ATPases. The Journal of biological chemistry. 2012 Aug 31; 287(36):30049-62. doi:10.1074/jbc.X112.402313. PMID:22822068
Okuno D, Iino R, Noji H Rotation and structure of FoF1-ATP synthase. Journal of biochemistry. 2011 Jun; 149(6):655-64. doi:10.1093/jb/mvr049. PMID:21524994
von Ballmoos C, Wiedenmann A, Dimroth P Essentials for ATP synthesis by F1F0 ATP synthases. Annual review of biochemistry. 2009; 78:649-72. doi:10.1146/annurev.biochem.78.081307.104803. PMID:19489730
Weber J ATP synthase--the structure of the stator stalk. Trends in biochemical sciences. 2007 Feb; 32(2):53-6. . PMID:17208001
Weber J ATP synthase: subunit-subunit interactions in the stator stalk. Biochimica et biophysica acta.; 1757(9-10):1162-70. . PMID:16730323

Original Publications

Loading